US Army Mycoplasma Fermentans Incognitus Patent

Rense.com
US Army Mycoplasma Fermentans Incognitus Patent - Read It And Weep
PART II
EXAMPLE 14

Molecular Cloning and Sequencing of M. fermentans incognitus

DNA was phenol extracted from sucrose-banded M. fermentans incognitus
derived from Sb51 cells which were first lysed by 0.5% sodium dodecyl
sulfate (SDS) and treated with proteinase K (200 mg/ml), for 1 hour at
60.degree. C. then 3 hours at 37.degree. C. The alcohol precipitated DNA
was treated with RNase. An EcoRI partial digest of the M. fermentans
incognitus-enriched DNA was cloned into bacteriophage lambda charon 28. The
lambda-recombinant clones were screened by differential plaque
hybridization, on duplicate sets of filters, with .sup.32 P-labeled DNA
derived from gradient banded M. incognitus versus that of normal NIH/3T3
cells. One clone which had specifically hybridized to M. fermentans
incognitus DNA probe, but not to 3T3 DNA probe was identified. The insert
of the positive phage clone was recloned into the EcoRI site of Bluescript
KS (M13) vector (Strategene). Two cloned probes, 8.6 kilobase (psb-8.6) and
2.2 kilobase (psb-2.2) were obtained. The specificity of probes psb-8.6 and
psb-2.2 was further verified by Southern blot analysis of DNA isolated from
M. fermentans incognitus and Sb51 cells versus normal NIH/3T3 cells. To
obtain sequence information, single-standed DNA of clone psb-2.2 was
prepared by infection of the cells with helper phage (Bluescript
instruction manual, Stragegene). About 200 base sequences starting from the
EcoRI site at one end of the insert fragment of psb-2.2 were obtained,
using a dideoxynucleotide sequencing method. The base sequence is set forth
in SEQ ID NO:2.

EXAMPLE 15

Southern Blot Hybridization of M. fermentans incognitus

Restriction endonuclease cleavage of M. fermentans incognitus or cellular
DNA was carried out with a 10-fold excess of enzymes under the conditions
recommended by the manufacturer (BRL).
The enzyme digests of DNA were subjected to gel electrophoresis in 1%
agarose and transferred onto nitrocellulose membranes by the Southern blot
method. Each filter was prehybridized at 42.degree. C. for at least 4 hours
in 50% formamide, 5x SSC (standard saline citrate), 0.2% SDS, 20 mM
Tris-HCl (pH 7.5), 2 mM EDTA, 5x Denhart's solution, and 350 microgram/ml
denatured salmon sperm DNA. Each filter was then hybridized with 10.sup.7
cpm of .sup.32 P-labeled probe (specific activity after hybridization, the
blots were washed at 60.degree. C. in 2x SSC, 0.5% SDS for 90 minutes with
three changes and then wrapped in sheets of saran wrap and exposed to Kodak
XAR film at -70.degree. C. with intensifying screens for 2-20 hours
depending upon the intensity of the hybridized signals. For the reuse of
the membrane, the filters were boiled in 0.1x SSC, 0.1% SDS for 10 minutes
to remove the previous M. fermentans incognitus probe after
autoradiographic exposure, and rehybridized with .sup.32 P-labeled insert
fragment of psb-8.6 as previously described.
Use of the filters and results of such use are presented in Example 19 below.

EXAMPLE 16

Analysis of Taq DNA Polymerase-Catalyzed PCR Amplification Products

The amplification of selective DNA sequences by Taq DNA polymerase chain
reaction is known (U.S. Pat. No. 4,683,202). Briefly, each 100 microliter
reaction mixture contained 1 microgram of human tissue DNA in 50 mM KCl, 10
mM Tris-HCl (pH 8.3), 1.5 mM MgCl.sub.2, each primer (RS47 (SEQ ID NO:13)
and RS49 (SEQ ID NO:14)) at 1 microM, each dNTP at 200 microM, gelatin at
100 micrograms/ml, and 2 units of Taq DNA polymerase. The mixtures were
heated at 94.degree. C. for 2 minutes before the addition of DNA
polymerase. The samples were overlaid with 50 microliters of mineral oil
and subjected to 35 cycles of selective DNA amplification. The thermal
cycle was manually conducted in three separate water baths as follows: 1
minute at 52.degree. C., 1 minute at 72.degree. C., and 30 seconds at
94.degree. C. After the amplification, the reaction was stopped by addition
of EDTA (final concentration, 20 mM). Ten microliter aliquots from each
sample product were removed and electrophoretically fractioned in a 6%
polyacrylamide gel. The fractionated DNA was electroblotted onto a Zeta
membrane (Bio/Rad) at 40 volts for 90 minutes, followed by denaturation and
fixation in 400 mM NaOH, 2 mM EDTA for 10 minutes at room temperature. The
Zeta membrane filter was rinsed three times with 2x SSC in 20 mM Tris-HCl
(pH 7.5), and air dried for 10 minutes. Prehybridization of the blots was
carried out as previously described except the solution contained 4x SSC
and 1% SDS. A 22-base synthetic oligonucleotide probe (RS48 (SEQ ID NO:1)),
was 5' end-labeled with .sup.32 P and hybridized to the filter at
30.degree. C. for 16 hours in the prehybridization solution containing 30%
formamide. The blots were washed at 34.degree. C. in 2x SSC, 0.5% SDS for
45 minutes with three changes and at 37.degree. C. for an additional 2
minutes.
Use of the blots and the results of such use are presented below in Example
19.
The preferred PCR assay utilizes primers RW004 and RW005 and probe RW006 as
described in
Example 5.

EXAMPLE 17

DNA and Antigen Dot-Blot Analysis of M. fermentans incognitus

After 11 cycles of cell-free M. fermentans incognitus transmission, the
control and M. fermentans incognitus infected NIH/3T3 cells of Example 13
were subjected to M. fermentans incognitus isolation (see Example 7,
above). Ten microliter and/or twenty microliter samples from each fraction
of the isopycnic sucrose gradient were first diluted to 400 microliters
with PBS and then dot-blotted onto nitrocellulose paper under vacuum. The
dot was blocked with 5% non-fat milk and reacted with pre-immunized or
post-immunized rabbit antiserum (1:400 in PBS) at 37.degree. C. for 3
hours. The blot was then developed with alkaline phosphatase conjugated
goat anti-rabbit IgG (1:5000, in PBS) at 37.degree. C. for 1.5 hours,
followed by the addition of the substrates Nitro Blue Tetrazolium (50 mg/ml
in 70% dimethylformide) plus 5-Bromo-4 Chloro Indolyl phosphate (50 mg/ml)
(Promega; Madison, Wis.). Between each of the above steps, the blots were
washed five times with PBS and Tween 20 (1%), five minutes each wash. For
homologous DNA detection, the dotted blots were alkaline treated,
neutralized and probed with .sup.32 P-labeled nick-translated psb51-8.6 or
psb51-2.2 probes as previously described in Example 14. Use of the blots
and the results of such use are presented below in Example 19.

EXAMPLE 18

Immunohistochemistry for Detecting M. fermentans incognitus Antigens in
Infected Tissues

Deparaffinized sections were incubated with 10% Bovine serum albumin (Sigma
Chemical Co.) in Tris-buffered saline (TBS, 0.05M Tris, pH. 7.4 saline) for
39 minutes, rinsed briefly with TBS, and covered with rabbit antisera from
Example 12 (1:100 dilution). Slides were refrigerated overnight. After
returning to room temperature, the slides were rinsed with 1% albumin in
TBS. Slides were then covered with secondary antisera. Biotin-labelled
horse anti-rabbit immunoglobulin (Vector Lab., Burlingame, Calif.) was
added at a 1:200 dilution as the secondary antisera, followed by the avidin
biotinylated peroxidase complex (ABC) reagent (Vector Lab., Burlingame,
Calif.). Each incubation step was conducted for 30 minutes with three TBS
washes between steps. The color reaction was developed in Diaminobenzidine
and H.sub.2 O.sub.2 substrate and counterstained with hematoxylin.

Rabbit antiserum which reacted specifically with M. fermentans
incognitus-Sb51 was used to stain formalin-fixed paraffin embedded lymph
node and brain tissues of patients with AIDS. In the immunohistochemical
study, reticuloendothelial cells or macrophages in the subcapsular sinus of
a lymph node (Table 4, patient #1) were most often stained positively (FIG.
13). Brain from the autopsy of a patient with central nervous system
symptoms and histopathologic evidence of subacute encephalitis without
known etiology, contained many positively stained degenerating cells in
lesions with diffuse infiltration of mononuclear lymphohistiocytes.
Positive immunochemical reactivity was located in both nuclei and cytoplasm
of swollen and disrupted cells. More peculiarly, brains from the autopsy of
three other patients with CNS symptoms, but without histopathological
evidence of encephalitis, also had numerous positively stained
inclusion-like spherical structures (FIG. 14). The structures, most likely
originating from neuroglial cells with unique pathological changes, were
inconspicuous in routine hematoxylin and eosin stained sections.

DNA from two of the three brains were available for PCR study and had
positive M. fermentans incognitus DNA information after selective gene
amplification (Table 4, patient #2 and #3). The positively stained
structures were more common in periventricular and perivascular areas.
Normal rabbit serum (Gibco Co.) and the rabbit serum obtained before
immunization with M. fermentans incognitus did not stain these brains.
Furthermore, the immunochemical reactivity of the rabbit antiserum with
either Sb51 cells or purified M. fermentans incognitus, but not with normal
NIH/3T3 cells or spontaneously transformed NIH/3T3 cells. Eleven autopsy
brain tissues obtained from non-AIDS patient were used as controls. Brains
from autopsies of patients with fatal rickettsial infection, bacterial
sepsis, disseminated mycobacteriosis and CNS metastatic disease served as
controls. No positive reaction was observed in these control non-AIDS
tissues.

TABLE 4
______________________________________
Clinico-Pathological Profiles of Patients
with AIDS and Analysis of Specific DNA
Amplification
Lane Results of
Clinical and/or
Tissue Position
DNA Ampli-
Post Mortem DNA for in fication
Subject
Diagnosis PCR FIG. 14
Analysis
______________________________________
1. 32 y.o.w. male
1) Spleen A-1 +++
homosexual, 2) LN A-2 +
PCP candida 3) Liver A-3 ++
esophagitis 4) Brain A-4 -
and cerebral
toxoplasmosis
2. 47 y.o.w. male
1) Brain A-5 +++
homosexual, 2) Liver A-6 +
KS, and CMV
infection,
CNS syndrome
3. 24 y.o.w. male
1) Brain B-1 +++
PCP, KS, and
CNS syndrome
4. 37 y.o.w. male
1) Spleen B-2 +++
homosexual,
PCP, and CMV
infection and
KS
5. 45 y.o.w. male
1) KS B-3 ++
homosexual,
KS, CMV and
PCP infection
6. 28 y.o.w. male
1) PBMC B-4 -
homosexual
with KS without
OI
7. 43 y.o.w. male
1) PBMC B-5 +
homosexual
with KS without
OI
8. 26 y.o.b. male
1) LN Not -
homosexual shown
with KS without
OI
9. 24 y.o.w. male
1) Spleen Not -
homosexual shown
with KS and
myocarditis
10. 31 y.o.w. male
1) Spleen Not +
homosexual shown
with KS, PCP,
CMV and MAI
infections
11. Diffuse 1) Spleen A-7 -
histiocytic
malignant
lymphoma
12. Renal cell 1) Liver A-8 -
carcinoma 2) Brain A-9 -
13. Chronic active
1) PBMC B-6 -
hepatitis B.
14. Metastic Ewing
1) Ewing B-7 -
sarcoma in sarcoma
lung and liver.
15. Normal delivery
1) Placenta
B-8 -
placenta.
______________________________________
Labels +++, ++, + and - denote highlevel, intermediate level, low level
and negative, respectively, for the relative intensities of the diagnosti
band observed in the autoradiograms in FIG. 15.
OI Opportunistic Infection
MAI Mycobacterium AviumIntracellular
KS Kaposi's sarcoma
LN Lymph node
PBMC Peripheral Blood Mononuclear Cells
PCR Polymerasechain reaction

EXAMPLE 19

DNA Probes for the Direct Detection of M. fermentans incognitus DNA in
Infected Tissues

DNA was extracted from the fractions of Example 6 and digested with EcoRI
enzyme. Two molecular clones carrying 8.6 kb and 2.2 kb inserts, designated
psb-8.6 and psb-2.2, were obtained. When used as probes, these clones
specifically hybridized to DNA of Sb51 cells (lanes 1, 2) but not to that
of parental NIH/3T3 cells (lanes 3, 4) (FIG. 15). These cloned probes were
used to assay infectivity of M. fermentans incognitus in cell cultures. The
gradient banded M. fermentans incognitus from Sb51 cells infected normal
NIH/3T3 cells after being filtered through at 0.22 micron filter. The
psb-8.6 probe specifically hybridized to DNA of NIH/3T3 cells which were
harvested after each round of cell-free M. fermentans incognitus
transmission (FIG. 16). Blotted filter containing 10 ug EcoRI digested DNA
from cells of sb.sub.51 (lane 1), original, normal NIH/3T3 cells (lane 2),
7th cycle cell-free VLIA transmission control NIH/3T3 cells (lane 3), 11th
cycle cell-free VLIA transmission control NIH/3T3 cells (lane 4), and 3rd
cycle (lane 5), 5th cycle (lane 6), 7th cycle (lane 7), 9th cycle (lane 8),
and 11th cycle (lane 9) of cell-free VLIA transmission in NIH/3T3 cells.
Lane 10 contained DNA of partially purified VLIA. The blot was probed with
p.sup.32 labeled psb.sub.51 -8.6. Similarly, the psb-2.2 probe also
specifically hybridized to DNA from M. fermentans incognitus infected
NIH/3T3 cells in each cycle of passage, but not from control NIH/3T3 cells.

The .sup.32 P-labeled psb-8.6 probe was also used for detection of M.
fermentans incognitus in isopycnic sucrose gradients which were originally
designed to band M. fermentans incognitus from Sb51 cells. M. fermentans
incognitus isolated after 11 cycles of cell-free passage in NIH/3T3 cells
had similar physical properties and was concentrated in the fractions of
density between 1.17 and 1.20 (gm/ml) (FIG. 17A). The parallel control
NIH/3T3 cultures following 11 cycles of cell-free transmission did not
contain M. fermentans incognitus. Immunochemical staining by rabbit
antiserum raised against M. fermentans incognitus originally isolated from
Sb51 cells also revealed that M. fermentans incognitus was localized in
these fractions (FIG. 18). FIG. 18A was stained using preimmunized rabbit
serum and FIG. 18B was stained with post-VLIA immunizations rabbit
antisera. Gel electrophoretic analysis of the end-labeled EcoRI or HindIII
digests of the gradient-banded M. fermentans incognitus indicated a minimum
molecular weight estimate for M. fermentans incognitus of greater than
150,000 bp.

To determine whether there was any significant homology of M. fermentans
incognitus to large human DNA viral agents, Southern blot hybridizations
were performed with each filter containing the restriction enzyme-treated
DNA from purified M. fermentans incognitus, NIH/3T3, and one of the
following viral genomic DNA: HSV-2, VZV, EBV, CMV, HBLV, vaccinia pox virus
and mouse CMV virus. Each filter was hybridized to .sup.32 P-labeled
corresponding viral DNA probe, then washed and analyzed by autoradiography.
The incorporated viral probe was subsequently removed by boiling the
filters before rehybridization with .sup.32 P-labeled insert fragment of
psb-8.6. No cross-hybridizations of M. fermentans incognitus probe psb-8.6
occurred to any of the human herpesviruses, vaccinia pox virus or mouse CMV
(FIG. 19). Southern blot hybridization comparing VLIA DNA to DNA from known
human herpesviruses, vaccinia virus, MCMV, and HVS. Blotted filters
contained DNA of VLIA (A-H, lanes 1, 2), normal NIH/3T3 (A-H, lanes 3, 4),
HSV-2 (A, lanes 5, 6) VZV (B, lanes 5, 6), EBV (C, lanes 5, 6), CMV (D,
lanes 5, 6), HBLV (E, lanes 5, 6), vaccinia virus (F, lanes 5, 6), MCMV (G,
lanes 5, 6), and HVS pT (H, lane 5). DNA in lanes 1, 3, and 5 were digested
by Eco RI: DNA in lanes 2, 4, and 6 were digested by Bam HI. HVS pT 7.4 (H,
lane 5) was digested with Taq I. The p.sup.32 labeled probes for set I were
HSV-1 pHSV-106 (A), VZV pEco A (B), EBV pBam W (C), CMV pCMH-35 (D), HBLV
pZVH-70 (E), vaccinia pEH-1 (F), MCMV pAMB-25 (G), and HVS pT 7.4 (H). Each
blot (A-H) of set I was boiled to remove incorporated viral probe and then
reprobed with p.sup.32 labeled insert fragment of psb-8.6 (set II).

Conversely, while they hybridized to the homologous genomic DNA, one of the
other viral probes hybridized to the lanes containing M. fermentans
incognitus DNA digested with either EcoRI or BamHI. pHSV-106 originated
from HSV type I hybridized to the genomic DNA of HSV type II, but not to
the M. fermentans incognitus DNA.

A viral probe of 7.4 kb DNA (pT 7.4) from Herpesvirus saimiri (HVS) of
squirrel monkeys was also examined. The viral probe did not hybridize to M.
fermentans incognitus DNA. In some of the rehybridized filters, very weak
bands resulting from incomplete removal of the previously hybridized viral
probes could be noted. The weak signals served as useful reference points
for the newly appearing bands obtained after rehybridization with psb-8.6
probe.

To investigate M. fermentans incognitus infection in humans, the recently
developed, a sensitive method of selective DNA amplification, polymerase
chain reaction (PCR) (U.S. Pat. No. 4,683,202) was used. (As discussed
above in Example 5, it is preferred to use RW004 (SEQ ID NO:15) and RW005
(SEQ ID NO:16) as primers because a more sensitive assay is possible with
these primers.) One end of the M. fermentans incognitus DNA in the psb-2.2
bluescript clone was sequenced. Primer pairs of synthetic oligonucleotides,
designated as RS47 (SEQ ID NO:13) and RS49 (SEQ ID NO:14), with M.
fermentans incognitus-specific sequences and Taq DNA polymerase were used
for 35 reaction cycles of M. fermentans incognitus specific DNA
amplification. The positions of RS47 (SEQ ID NO:13) and the complementary
sequences of RS49 (SEQ ID NO:14) span the first 160 nucleotides of psb-2.2
M. fermentans incognitus DNA (SEQ ID NO:2). The amplified DNA carrying M.
fermentans incognitus-specific genetic information revealed positive
signals, when probed with .sup.32 P end-labeled synthetic oligonucleotides
RS48 representing a segment of the intervening sequences between RS47 (SEQ
ID NO: 13) and RS49 (SEQ ID NO:14).

Ten patients with AIDS have been examined and were seropositive for HIV and
had either typical opportunistic infections such as pneumocystic carinii
pneumonia (PCP), toxoplasmosis, CMV infection or Kaposi's sarcoma (Table 4,
subjects #1 to #10). Analysis of the amplified DNA products revealed that a
diagnostic 160 bp DNA fragment and a slower migrating fragment(s)
associated with a positive homologous signal, were identified in samples
derived from seven of the ten AIDS patients tested. Representative results
of nine positive samples and two negative samples obtained from seven AIDS
patients are shown in FIG. 20. No positive signal could be detected in any
of the six DNA samples derived from five control non-AIDS subjects (Table
4, subjects #11 to #15). As summarized in Table 4, patient #1 had M.
fermentans incognitus genetic material in the lymph node, liver and spleen
but not in the brain. However, both patients #2 and #3 had positive M.
fermentans incognitus-specific DNA products in the brain samples.

EXAMPLE 20

Vaccine Containing Cells Infected by M. fermentans incognitus

Sixteen chimpanzees are divided into four groups. Group A is inoculated
intravenously with 1 ml of the novel M. fermentans incognitus. Group B is
inoculated with 1 ml of fluid containing 10.sup.6 M. fermentans
incognitus-infected NIH/3T3 cells. Group C is inoculated with 1 ml of fluid
containing 10.sup.6 inactivated M. fermentans incognitus-infected NIH/3T3
cells, and Group D is the control group and did not receive an inoculation.

All chimpanzees in Groups A and B developed symptoms of AIDS. However, none
of the chimpanzees in Groups C and D developed the symptoms of AIDS. The
chimpanzees of Group C are rendered immune to subsequent challenge of
intravenous inoculation with 1 ml of M. fermentans incognitus or 1 ml
containing 10.sup.6 M. fermentans incognitus-infected NIH/3T3 cells.

EXAMPLE 21

M. fermentans incognitus Identified In Non-AIDS Patients

Six patients from six different geographic areas who presented with acute
flu-like ilnesses were studied. The patients developed persistent fevers,
lymphadenopathy or diarrhea, pneumonia, and/or heart, liver, or adrenal
failure. They all died in 1-7 weeks.

These patients had no serological evidence of HIV infection and could not
be classified as AIDS patients according to CDC criteria. The clinical
signs as well as laboratory and pathological studies of these patients
suggested an active infectious process, although no etiological agent was
found despite extensive infectious disease work-ups during their
hospitalization.

Post-mortem examinations showed histopathological lesions of fulminant
necrosis involving the lymph nodes, spleen, lungs, liver, adrenal glands,
heart, and/or brain. No viral inclusion cells, bacteria, fungi, or
parasites could be identified in these tissues using special tissue stains.
However, the use of rabbit antiserum and the monoclonal antibodies raised
against M. fermentans incognitus (Example 8), the pathogen shown to cause
fatal systemic infection in primates (Example 10), revealed M. fermentans
incognitus antigens in these necrotizing lesions. In situ hybridization
using a .sup.35 S labeled M. fermentans incognitus-specific DNA probe
(Example 18) also detected M. fermentans incognitus genetic material in the
areas of necrosis.

Furthermore, M. fermentans incognitus particles were identified
ultrastructurally in these histopathological lesions. M. fermentans
incognitus was associated with the systemic necrotizing lesions in these
previously healthly non-AIDS patients with an acute fatal disease.

Typical areas of necrosis due to the M. fermentans incognitus infection of
these patients are shown in FIG. 21. Most of the tissues which had massive
necrosis showed only minimal lymphocytic or histiocytic response and few
neutrophils (FIGS. 21A, B and C). FIG. 21A is a photomicrograph of splenic
tissue (x 30.5). FIG. 21B shows the peripheral margin of necrosis of 21A (x
153). FIG. 21C is a photomicrograph of lymph node tissue (x 15.25).
Occasionally, a chronic or acute inflammatory reaction could be identified
in the areas of necrosis (FIG. 21D). FIG. 21D is a photomicrograph of
adrenal gland tissue (x 153).

Representative samples of the immunostained tissues of these patients are
shown in FIGS. 22A-D. FIG. 22A is a photomicrograph of spleen tissue (x
80). FIG. 22B is a higher magnification of the margin of necrosis of 22A (x
353). FIG. 22C is a photomicrograph of lymph node tissue (x 257). FIG. 22D
is a higher magnification of cells with positive cytoplasmic staining of
22C (x 706). FIG. 22E is a photomicrograph of hemorrhagic necrosis in
adrenal gland tissue (x 706). The areas which displayed the highest
concentration of M. fermentans incognitus related antigens were often at
the margin of necrosis.

However, the necrotic center and peripheral unaffected areas had relatively
low reactivity. Most of the positively stained cells were identified as
lymphocytes or histiocytes in the lymph nodes and spleen, or reactive
mononuclear cells in the liver, lungs, adrenal glands and heart.

Immunostaining of control tissues with necrotizing lesions from patients
with cat scratch disease, Hodgkin's disease, malignant lymphoma,
cryptococcal fungal infections and hemorrhagic splenic tissues of Hairy
cell leukemia did not display a positive reaction. Serum obtained from the
same rabbit before immunizaiton with M. fermentans incognitus antigens also
failed to display a positive immunoreaction in the necrotizing lesions of
the six patients.

Using a .sup.35 S radiolabeled psb-2.2 M. fermentans incognitus DNA probe
(Example 18), strong labeling of clusters of cells at the margins of
necrosis of the affected tissues was observed. The affected tissues tested
were formalin-fixed, paraffin-embedded spleen, lung, lymph node, adrenal
gland liver and bone marrow. The intensity of the labeling, or the number
of grains localized in the cells at the margin of necrosis was well above
the level present at either the necrosis (FIGS. 23A and B). However, there
were also clusters of apparently viable cells in the necrosis which were
also strongly labeled (FIG. 23C). FIG. 23A shows strong labeling of cells
at the peripheral zone of necrosis (x 76.5). FIG. 23B is a higher
magnification of 23A (x 422). FIG. 23C shows the occasional positive
labeling in an area of diffuse necrosis in the spleen (x 150). The inset of
23C is a higher magnification (x 422).

Formalin-fixed, paraffin-embedded liver and spleen tissues from a patient
with pancreatic carcinoma were used as negative controls, and showed no
labeling above background levels. A control probe of .sup.35 S labeled
cloning vector DNA, not containing psb-2.2 M. fermentans incognitus DNA did
not label any of the tested tissues (FIG. 23D). FIG. 23D is the same area
of FIG. 23C in the consecutive tissue section, hybridized with .sup.35 S
labeled cloning vector DNA not containing psb-2.2 M. fermentans incognitus
DNA (x 150) (i.e., control for 23C).

Areas of the necrotizing lesions which immunostained most positively for M.
fermentans incognitus specific antigens were examined by electromicroscopy.
Particles with characteristic ultrastructural features of M. fermentans
incognitus were directly identified in all the lesions. These particles in
the areas of necrosis, morphologically resembled M. fermentans incognitus
previously identified in Sb51 cells (Example 4) and in the tissues of
experimentally inoculated monkeys (Example 10). The particles were
heterogeneous in size and shape, with most particles being spherical and
about 140 to 280 nm in diameter. At the margin of necrosis, the M.
fermentans incognitus particles were located in the cytoplasm of cells with
apparently no cytopathic changes, or in fragments of cytoplasm from
completely disrupted cells (FIG. 24). FIG. 24 shows electron mircographs of
tissues derived from areas highly positive for M. fermentans
incognitus-specific antigens. FIG. 24A is an electron micrograph at a
margin of necrosis in adrenal gland tissues (Bar=1,000 nm). FIG. 24A.sub.2
is a higher magnification of 24A (Bar=100 nm). FIGS. 24B.sub.1, and B.sub.2
are electron micrographs of the peripheral zone of necrosis in lymph node
tissue (Bar=1,000 nm). FIG. 24B.sub.3 is a higher magnification of
24B.sub.2 (Bar=100 nm).

Table 5, below, summarizes the profiles and histopathological findings for
each of the six patients.

TABLE 5
__________________________________________________________________________
Summary of Patient's Profiles and Histopathological Findings
Tissue with necrotic
Duration
lesions identified
Personal
Salient clinical of illness by biopsy or at Patient
Profiles presentation (weeks) autopsy
__________________________________________________________________________
1 29-year old
arthralgia, myalgia, conjunc-
4.5 spleen, lung
black man
tivitis, persistent fever,
hypercalcemia, liver failure
(late), ARDs* (late)
2 33-year old
persistent fever, diarrhea,
7 lymph nodes, liver,
white woman
generalized lymphadenopathy,
spleen, kidneys
abnormal liver functions,
seizure (late)
3 40-year old
arthralgia, myalgia, sore
3.5 adrenal glands
white man
throat, chest pain, persis-
(bilateral), heart,
tent fever, malaise, diarrhea,
brain
finger numbness, comatose
(late)
4 31-year old
vomiting and diarrhea, tremor,
1.5 liver, spleen
black woman
fever, epigastric and chest
pain, abnormal liver functions,
headache
5 23-year old
Watery diarrhea, vomiting,
3 liver, heart
white man
jaundice, arthralgia, myalgia
6 33-year old
fever, malaise, nausea and
1 spleen, liver
black man
vomiting, myalgia and weakness,
liver failure and jaundice,
confusion and hallucinations
(late)
__________________________________________________________________________
*ARDS Adult Respiratory Distress Syndrome

EXAMPLE 22

Biochemical Properties and Characteristics of M. fermentans incognitus

In order to identify biochemical properties and characteristics of M.
fermentans incognitus, a variety of analyses were performed on this
pathogen. The analyses of biochemical properties, antigenic specificity,
DNA homology and restriction pattern analysis show that M. fermentans
incognitus is distinct from all other know species of human mycoplasma, but
appears to be biologically, sereologically and molecular incognitus, a
rarely isolated human mycoplasma genetically most closely related to M.
fermentans, a rarely isolated human mycoplasma.

M. fermentans incognitus from culture supernatant of Sb51 cells (Example 4)
was cultured in cell-free conditions using a modified SP-4 medium. SP-4
broth was prepared according to previously described procedures (Whitcomb,
R. F., Methods in Mycoplasmology, Vol. I, Academic Press, Inc. pp. 147-158
(1983) and Tully, J. G. et al., Science 195, 892 (1977)), and then
supplemented with 20% heat inactivated fetal bovine serum (FVS) (M.A.
Bioproducts Cat. #14-901B, Lot No. 8M0320 for hybridoma). Modified SP-4
broth medium was further supplemented with 0.15 mg/ml niacin (nicotinic
acid, Sigma), 0.15 mg/ml riboflavin (Sigma) 0.15 mg/ml L-arginine and 0.01
mg/ml nicotinamide adenine dinucleotide (NADH, Pharmacia). Modified SP-4
agar medium containing 1% Noble agar (Gibco) was dispensed into sterile
plastic petri-plates (Falcon).

The cell debris from the Sb51 cells was first removed from 5 day-old
culture supernatant by centrifugation at 1,500 rpm for 15 minutes.
Thesupernatant was then pelleted in Sorvall superspeed centrifugation
10,000 rpm for 20 minutes. The particles pelleted from 50 ml of culture
supernatant were resuspended in 1 ml of modified SP-4 medium and used as
inoculum. The M. fermentans incognitus-containing suspension was 1:10 fold
serially diluted with SP-4 medium and then inoculated (0.2 ml) into
modified SP-4 broth culture medium (2 ml).

Culture incubation and observation

All broth cultures and agar media plates were either incubated at
37.degree. C. or 30.degree. C. in anaerobic Gas Pak jars (BBL, Microbiology
Systems, Cockeyville, Md.), candle jars or in a regular incubator. The
broth media were examined daily for three weeks. Broth cultures were
observed macroscopically against a white background to facilitate detection
of color changes. Positive broth cultures were confirmed by subculturing
0.1 ml volumes to fresh modified SP-4 both and agar plates as soon as any
color change was detected.

The surface of the agar plates was scanned with the use of a low-power
objective (X4) from a standard light microscope or an inverted microscope.
Positive cultures were identified by characteristic colony morphology.

For the studies of antigenic and DNA analysis, M. hyorhinis 9ATCC #17981),
M. orale (ATCC #23714), M. pneumonia (ATC #15531), M. hominis (ATCC
#15488), M. genitalium (ATCC #33530), M. salvarium (ATCC #23064), M.
fermentans incognitus and Acholeolasma laidlawii (ATCC #23206) strains were
cultured in modified SP-4 broth. U. urealyticum (ATCC #27618) was cultured
in modified SP-4 broth supplemented with 0.03% urea.

The broth cultures appeared slightly turbid and an acidic shift in pH
occurred after 10 to 14 days of incubation either at 30.degree. C. or
37.degree. C. Cells grew slightly better in a candle jar than in aerobic
conditions; observation of a pH shift usually occurred about one day
earlier.

M. fermentans incognitus could be filtered through a 220 nm membrane filter
and continued to grow in the broth filtrate. The cells grown in the
modified SP-4 broth were examined by electron microscopy after either
ultrathin sectioning or direct negative staining. Clusters of cell
wall-free microorganisms which were bound by a single triple layered
membrane, showed typical plemorphic morphology of Mollicutes.

Most of the particles were spherical, but filamentous forms with occasional
branching configuration, were also observed (FIG. 1A). In general, the
average size of spherical M. fermentans incognitus particles in the broth
cultures appeared to be much smaller than that of M. fermentans (180 nm
versus 460 nm).

M. fermentans incognitus could also produce colonies on 1% Noble agar
plates prepared from modified SP-4 media. Compared with some other human
mycoplasmas, M. fermentans incognitus grew rather slowly and formed only
small colonies (FIG. 1C). For comparison, colonies with a regular size and
sharp edge formed by M. fermentans incognitus growing in a parallel
modified SP-4 medium agar plate after a shorter incubation period are shown
in FIG. 1D. The small colonies of M. fermentans incognitus became
microscopically visible after 10 to 14 days of incubation. Most of the
colonies were somewhat diffuse and irregular, and much of their growth
occurred within the agar. However, under an inverted phase microscope, the
small central area of the colony was found to grow even deeper into the
agar and exhibited the appearance of a "fried egg" (FIG. 1C).

A single typical colony of M. fermentans incognitus was picked three times
from consecutive agar plates. The cloned agent was then continuously grown
and passed in the broth of modified SP-4 medium. There was no evidence of
cell wall growth or conversion into a bacterium, when M. fermentans
incognitus was cultured and passed in an antibiotic-free medium.

In order to verify the definite relationship between M. fermentans
incognitus and what was previously identified as VLIA from Sb51 cells
(prior patent application Ser. No. 265,920, filed Nov. 2, 1988), DNA from
this cloned M. fermentans incognitus was isolated and compared with that of
Sb51 cells containing VLIA. The DNAs were first digested with EcoRI,
HindIII and PstI restriction enzymes. In the analysis of a Southern blot
probed with either psb-8.6 or psb-2.2, DNA of M. fermentans incognitus
grown in a cell free condition using modified SP-4 medium was identical to
DNA of VLIA in Sb51 cells (FIG. 25). This tertially cloned M. fermentans
incognitus was later used for all the following assays in this study.

FIG. 25 shows analysis and comparison of DNA restriction patterns of VLIA
and M. fermentans incognitus. Blot (A) and blot (B) were probed with
.sup.32 P nick translated inserts of psb-8.6 and psb-2.2, respectively.
Each lane in the gel contained 1 microgram of DNA from sb51 cells infected
with VLIA (lanes 1,2,3) and control NIH/3T3 cells (lanes 4,5,6) or 1
nanogram of DNA from M. fermentans incognitus cultured in modified SP-4
broth (lanes 7,8,9). DNA was predigested with restriction enzymes EcoRI
(lanes 1,4,7) HindIII (lanes 2,5,8) and PstI (lanes 3,6,9). Arrows
indicated the positions of standard size maker 23, 9.4, 6.7, 4.4, 2.3, and
2.0 kbp, respectively.

Biochemical characterization

The tests of glucose breakdown by oxidation or fermentation, and hydrolysis
of arginine or urea were performed according to standard bacteriological
techniques for the characterization of mycoplasma species (Alvotto, B. B.
et al., Intl. J. Systematic Bacteriology 20, 35 (1970)). Specifically,
glucose, arginine and urea media were prepared by adding 10 ml of 10% (w/v)
test substrate and 1 ml of 0.5% (w/v) phenol red to 74 ml of modified SP-4
broth without glucose. Each medium was adjusted using 5N HCl or 4N NaOH to
the following initial pH values: glucose medium, 7.6; arginine medium, 7.0;
and urea medium, 7.0. Each broth medium was filtered through a 0.22
micrometer filter and dispensed in 5 ml amounts into screw-capped tubes.

All inoculated cultures were incubated at 37.degree. C. Anaerobic cultures
were kept in Gas Pak jars (Gibco) and candle jars. Tests were read daily. A
drop of 0.5 pH unit or more in the glucose tube compared with the
appropriate substrate control tube constituted a positive reaction; a rise
of 0.5 pH unit or more in the arginine or urea tubes compared with the
appropriate substrate control tubes constituted a positive test. The pH
values were read by comparison with a set of standards ranging from pH 5.6
to 8.4. Positive and negative test control organisms were:

A) Glucose breakdown (both aerobic catabolism and fermentation)
Positive: M. fermentans and M. hyorhinis
Negative: M. orale

B) Arginine hydrolysis:
Positive: M. fermentans and M. orale
Negative: M. hyorhinis

C) Urea hydrolysis:
Positive: Ureaplasma urealyticum
Negative: M. fermentans

In comparison with other known species of human mycoplasmas, including M.
pneumoniae and M. fermentans incognitus, M. fermentans incognitus appeared
to be more fastidious in cultivation and did not grow in the conventional
mycoplasma media (Table 5, presented at the end of this Example). Modified
SP-4 (with the further addition of NADH, niacin and riboflavin) was the
only medium able to support a continuous growth of M. fermentans
incognitus. Serum was a necessary supplement which could not be replaced by
albumin. Increased fetal bovine serum concentrations (at least up to 10 to
15% of supplement) in the modified SP-4 medium produced a growth response.

M. fermentans incognitus catabolized glucose under both aerobic and
anaerobic conditions of cultivation (Table 6). M. fermentans
incognitushydrolyzed arginine and produced an alkaline shift in pH, albeit
slower than M. fermentans incognitus. A prominent alkaline shift in pH
occurred after an initial brief acidic shift in the M. fermentans
incognitus broth culture. M. fermentans incognitus could not hydrolyze urea
in the bichemical assay. The usual biological characteristics of this
microorganism are apparently distinct from all the other human species but
similar to M. fermentaas, another glycolytic and arginine-metabolizing
mycoplasma (Kenny, G. E., Manual of Clinical Microbiology, American Society
for Microbiology, Washington, D.C 4th Ed., pp.d 147-158) (1985)).

TABLE 6
__________________________________________________________________________
Comparison of Growth and Biochemical Properties of Mycoplasma
incognitus to Eight Other Mollicutes
Species
AL MA MHO MHY MP MO UU MF MI
__________________________________________________________________________
(I) Ability of Growth in Different
Culture Media*:
Hayflick + + ND ND + + ND + -
Brain & Heart Infusion Broth
+ ND ND ND ND ND ND .+-.
-
Mycotrim-TC + ND ND ND ND + ND + -
Heart Infusion Broth
+ ND ND ND ND + ND + -
Arginine Broth + + ND ND ND ND ND + -
Boston Broth + + ND ND ND ND ND + -
A7 Agar + + ND ND ND ND ND + -
SP-4 + + ND ND ND ND ND + .+-.
Modified SP-4 + + + + + + +** + +
(aerobic and candle jar)
(II)
Biochemical Properties:
Glucose Breakdown
Oxidation (aerobic culture)
ND - ND + ND - ND + +
Fermentation (anaerobic
ND - ND + ND - ND + +
culture)
Arginine Hydrolysis
ND + ND - ND + ND + +
Urea Hydrolysis ND ND ND ND ND ND + - -
__________________________________________________________________________
*All the culture media were supplemented with 20% fetal bovine serum.
**The SP4 medium was supplemented with urea.
AL: A. laidlawii, MA: M. arginini, MHO: M. hominis, MHY: M. hyorhinis, MP
M. pneumoniae, MO: M. orale, UU: U. urealyticum, MF: M. fermentans, MI: M
incognitus ND: Not done in this study.

Southern blot DNA analysis

Restriction endonuclease cleavage and Southern blot hybridization using
nick translated psb-8.6 nd psb-2.2 probes as well as .sup.32 P end-labeled
RS48 were described previously (Examples 13-17). A cDNA probe of E. coli
r-DNA (23S and 16S r-RNA, Pharmacia Cat. #27-2508-01) was prepared with
.sup.32 P alphadeoxyadenosine triphosphate by random primer extension
method (Feinberg, A. P. et al., Anal. Biochem. 132, 6 (1983)) using cloned
Moloney murine leukemia virus reverse transcriptase (from BRL) and random
primer (Pharmacia) under the conditions recommended by the manufacture of
BRL. Two tenth micrograms of purified DNA isolated from cultures of each
species of mycoplasa were applied to each lane for gel electrophoresis
after restriction enzyme digestion.
Molecular cloning of M. fermentans incognitus DNA

DNA was phenol extracted from a pure culture of M. fermentans incognitus
grown in modified SP-4 medium. The alcohol precipitated DNA was treated
with Rnase. A HindIII digest of the M. fermentans incognitus DNA was cloned
into M13 mp18 Vector (Norrander, J. et ll., Gene 26, 101 (1983)). The M13
mp18 recombinant clones were screened by plaque hybridization, on
nitrocellulose filters, with .sup.32 P-labeled DNA derived from M.
fermentans incognitus. One clone which had specifically hybridized to M.
fermentans incognitus DNA probe was identified. The insert of 3.3 kilobase
M. fermentans incognitus DNA (MI-H 3.3) was identified in the cloned probe.
The cloned probe MI-H 3.3 used for Southern blot DNA analysis, had been
radiolabeled with .sup.32 P alpha-deoxyadenosine triphosphate by the chain
elongation method (Lo, S-C et al., Am. J. Trop. Med. Hyg. 41, 380 (1989)
and Messing, J. et al., Methods of Enzymology Vol. 101, Academic Press,
Inc., pp-2078 (1983)) using the M13 universal sequencing primer (17 mer,
USBC Co.) and the Klenow fragment of DNA polymerase I (USBC Co.).

Development and isotyping of monoclonal antibodies

Balb/c mice were immunized with heat inactivated (60.degree. C. for 20
minutes) M. fermentans incognitus in complete Freund's adjuvant through the
interperitioneal route. The mice were subsequently boosted twice at
biweekly intervals, three weeks after the initial injection, with heat
inactivated M. fermentans incognitus material in incomplete Freund's
adjuvant. Four days after the last boost, the spleen was removed and the
spleen cells were fused with NS1 myeloma cells using polyethylene glycol as
described in Galfre and Milstein (Methods of Enzymology Vol. 73, Academic
Press, Inc., pp. 3-46 (1981)).

The fused cells were then added to 96-well microtiter plates in
hypoxanthine, aminopterin and thymidine supplemented medium to eliminate
unfused myeloma cells. Culture supernatants in each well were then tested
for the production of antibody by using M. fermentans incognitus
antigen-coated microtiter plates in an ELISA system.

Selected hybridomas were cloned by the limiting dilution assay in 96-well
microtiter plates. Supernatants from wells demonstrating active growth were
re-tested for antibody activity in the ELISA system. The specificity of the
monoclonal antibodies was further crossed-checked by using M. fermentans
incognitus, Sb51 and NIH/3T3 cell antigen-coated microtiter plates. The
generation of ascites fluid was accomplished by injecting ten million
hybridoma cells into the perioneal cavity of Balb/c Nu/Nu mice which had
been primed with 0.5 ml of pristane, 5-7 days earlier. Ascites were
harvested by inserting a 20 gauge needle and withdrawing the fluid. The
material was clarified by centrifugation at 2500 rpm (300x g) for 10
minutes, and stored at -70.degree. C. Isotyping was done using reagents
from isotyping kit (Screentype, Boehringer Mannheim Biochemicals) and
Bio-Dot apparatus (Bio-Rad).

Analysis of genomic DNA by restriction enzyme mapping and comparison of
specific sequence homology were extremely useful in comparing different
species of mycoplasma. Ten different species of mycoplasma, M. orale, M.
hyorhinis, M. pneumonia, M. arginini, M. hominis, M. fermentans, M.
genitalium, M. salivarium, U. urealyticum and A. laidlawii were obtained
from ATCC and cultured in the modified SP-4 broth medium with or without
specific supplement. DNA isolated from M. fermentans incognitus and these
mycoplasmas was analyzed on Southern blots and probed with .sup.32 P
labeled cloned M. fermentans incognitus DNA (psb-8.6, psb-2.2) or synthetic
oligonucleotide (RS48).

FIG. 3 shows a comparison of DNA homology and restriction patterns between
M. fermentans incognitus and other human mycoplasmas. The blots were probed
with .sup.32 P.sub.-- translated, psb-8.6 (A), psb-2.2 (B), .sup.32 P
end-labelled RS48 (C), .sup.32 P labeled MI-H 3.3 (D) and .sup.32 P labeled
cDNA probe of E. coli ribosomal RNA (E). Each lane contained 0.2 microgram
of EcoRI enzyme pre-digested DNA from Acholeplasma laidlawii (lane 1), M.
arginini (lane 2), M. hominis (lane 3), M. hyorhinis (lane 4), M.
pneumoniae (lane 5), M. orale (lane 6), M. fermentans incognitus (lane 7)
and M. fermentans incognitus (lane 8). Arrows indicate the positions of
standard size marker 23, 9.4, 6.7, 4.4, 2.3, and 2.0 kbp, respectively.

One additional molecular clone, carrying the 3.3 kilobase insert of M.
fermentans incognitus DNA, designated MI-H 3.3, was also used as a probe in
the study. Although some homology with psb-2.2 was observed in the M. orale
genome (FIG. 3B), no homology with RS48 (SEQ ID NO:1), the specific DNA
sequences occurring at one terminal end of psb-2.2, and no homology with
psb-8.6 or MI-H 3.3 could be identified in the M. orale genome.

However, DNA homology with psb-8.6, psb-2.2, RS48 and MI-H 3.3 were all
found in the M. fermentans genome (FIG. 3A, B, C, D), but, the restriction
patterns revealed by these probes were different between M. fermentans and
M. fermentans incognitus. No similar DNA homology could be found in any
other species of mycoplasma.

There is significant homology between the ribosomal RNA (r-RNA) genes of
procaryotic mycoplasmas and those of Escherichia coli bacterium (Gaobel, U.
B. et al., Science 226, 1211 (1984)). The same blot which had been probed
consequently with RS48 and MI-H 3.3, was reprobed with .sup.32 P labeled
cDNA of E. coli r-RNA, after removing the previously incorporated probes by
boiling the filter. This analysis of r-RNA genes revealed both a difference
in numbers and size of the hybridization bands with each different species
of mycoplasma tested (FIG. 3E). The characteristic restriction enzyme
mappings of r-RMA genes in these Mollicutes enable the identification of
related species. The EcoRI restriction pattern of r-RNA genes of M.
fermentans incognitus and M. fermentans appeared to be identical (FIG. 3E)
and was different from any other mycoplasma tested.

Antigenic analysis using polyclonal and monoclonal antibodies

The microorganisms harvested from each culture were washed once in
phosphate buffered saline (PBS) and then resuspended in PBS. Protein
concentrations of each suspension were determined using the Bio-Rad protein
assay kit (Bio-Rad instruction manual). Antigenic analysis with polyclonal
and monoclonal antibodies was done using the Bio-Dot microfiltration
apparatus (Bio-Rad).

One hundred microliter samples from each dilution which contained
decremental amounts (either 1:4 or 1:10 dilution in PBS) of proteins were
dot-blotted onto nitrocellulose paper under vacuum. The blots were blocked
with 5% non-fat milk and reacted with either M. fermentans incognitus
specific rabbit antiserum (1:1000 in PBS) (Lo, S-C et al., Am. J. Trop. Med
Hyg. 40, 215 (1989)), or M. fermentans incognitus specific mule antiserum
(1:4000 in PBS), provided by Dr. Richard A. Dol Guidice of Frederick, Md.
The titers of the rabbit M. fermentans incognitus antiserum and the mule M.
fermentans incognitus antiserum had previously been determined to be 20,000
and 80,000, respectively.

The blots were then reacted with biotinylated goat antirabbit IgG (Vector)
and biotinylated goat antihorse IgG (Vector), respectively. In the
antigenic analysis using monoclonal antibodies, the concentration of
primary antibody was adjusted to 20 fold of each monoclonal antibody titer.
The titers of these monoclonal antibodies were previously determined to be
D81E7, 5.1.times.10.sup.4 ; C69H3, 2.6.times.10.sup.4 ; F89H7,
2.0.times.10.sup.5 ; B109H8, 2.6.times.10.sup.4 ; F11C6, 6.4.times.10.sup.3
; and C24H10, 2.6.times.10.sup.4. The biotinylated horse antimouse IgG or
goat antimouse Igm (Vector) were used as the secondary antibodies according
to the specific isotype of each monoclonal antibody. Each incubating step
was conducted for 30 minutes at room temperature with three Tris buffered
saline-Tween 20 (0.2%) washes between steps. The color reaction was
developed in diaminobenzidine and H.sub.2 O.sub.2 substrate after formation
of avidin-biotin complex.

Both biological characterization and DNA homology analysis indicated that
M. fermentans incognitus was distinct from all other species of human
mycoplasmas, but closely related to M. fermentans incognitus. Therefore, a
detailed comparison between these two species was performed by studying
their specific antigenicity.

Polyclonal rabbit antiserum raised originally against VLIA-Sb51 (Lo, S-C et
al., Am. J. Trop. Med. Hyg. 40, 339 (1989)) was found to react with M.
fermentans in addition to M. fermentans incognitus, but not with any other
mycoplasmas examined (FIG. 2A). However, a larger amount of M. fermentans
protein (>0.63 mg) was required to elicit the positive immunochemical
reaction in this assay. The positivity of reaction quickly disappeared when
the M. fermentans proteins were further diluted. In comparison, a 250-fold
to 1000-fold lower concentration of M. fermentans incognitus proteins still
carried a sufficient amount of antigenic determinants and exhibited
positive reactions in the assay (FIG. 2A).

In the parallel assay, antiserum raised specifically against M. fermentans
also reacted intensely with M. fermentans incognitus (FIG. 2B). The M.
fermentans-specific antiserum appeared to cross react with A. laidlawii and
M. orale when high concentrations (10 mg) of mycoplasma proteins were
dot-blotted. M. fermentans antiserum reacted with the antigens of M.
fermentans incognitus proteins. Both M. fermentans incognitus and M.
fermentans proteins could be diluted to 40 ng per well and still elicit a
positive reaction (FIG. 2B).

FIG. 2 shows antigenic comparison of M. fermentans incognitus, M.
fermentans and other human mycoplasmas in immunoblots. Upper blot (A) was
immunostained with rabbit antiserum raised specifically against M.
fermentans incognitus. Lower blot (B) was immunostained with rabbit
antiserum raised specifically against M. fermentans. The concentration of
mycoplasma protein was dot-blotted decrementally (1:4 dilution) from lane 1
(10 mg) to lane 12 (2.5 pg). Row A (M. arginini), row B (A. laidlawii), row
C (M. fermentans), row D M. hominis), row E (M. orale), row F (M.
hyorhinis), row G (M. pnuemonia), row H (M. fermentans incognitus). In FIG.
2 (C) row A, B, C, D and F were immunostained with monoclonal antibodies
D81E7, C69H3, F89H7, B109H8, F11C6 and C42H10, respectively. The
concentration of mycoplasma protein was dot-blotted decrementally (1:10
dilution) from lane 1 (10 ug) to lane 8 (1 pg). Row a (M. fermentans
incognitus) and Row b (M. fermentans).

In order to examine the possibility suggested by the above results that M.
fermentans incognitus carried additional unique antigens which are not
present in M. fermentans, a battery of monoclonal antibodies raised
specifically against M. fermentans incognitus were prepared. All six M.
fermentans incognitus monoclonal antibodies obtained, many with different
isotypes, were found to react only with M. fermentans incognitus but not
with M. fermentans (FIG. 2C). These monoclonal antibodies also did not
react with any of the other nine Mollicutes examined.
Table 7 summarizes the results of the antigenic analysis using both
polyclonal and monoclonal antibodies. The results confirmed that M.
fermentans incognitus carries additional specific antigens which could not
be identified in M. fermentans.

TABLE 7
__________________________________________________________________________
Characterization and Comparison of Antigenicity Between Mycoplasma
incognitus and Seven Other Mollicutes
Species
ANTIBODIES
ISOTYPE MA AL === MHO MO MHY MP ===
__________________________________________________________________________
Rabbit antiserum
Polyclonal
- - - - - - - +++
Against MI
Mule antiserum
Polyclonal
- .+-.
+++ - .+-.
- - +++
against MF
D81E7 Monoclonal
- - - - - - - +++
IgM/K
C69H3 Monoclonal
- - - - - - - +++
IgM/K
F89H7 Monoclonal
- - - - - - - +++
IgM/K
B109H8 Monoclonal
- - - - - - - +++
IgG3/K
F11C6 Monoclonal
- - - - - - - +++
IgG3/K
C42H10 Monoclonal
- - - - - - - +++
IgG1/K
__________________________________________________________________________
Labels +++, +, .+-. and - denote the relative positivity of immunostainin
results in FIG. 4. MA: M. argini, Al: A. laidlawii, MF: M. fermentans,
MHO: M. himinis, MO: M. orale, MHY: M. hyorhinis, MP: M. pneumoniae, MI,:
M. incognitus

Direct immunofluorescense examination

Monoclonal antibody was purified from ascites fluid by high-salt
precipitation and gel chromatography using Sephacryl-200 (Campbell, D. H.
et al., Method in Immunology 2d Ed., W. A. Benjamin, Inc., p. 198 (1970)).
Labeling of the purified antibody with fluorescein isothiocyanate (FITC)
was done using the method described by Rinderknecht (Nature 193, 167
(1962)). The broth culture suspensions were directly smeared on the slides.
The slides were air dried, fixed in 70% acetone, 30% methanol and stored at
4.degree. C. The slides were directly immunostained with FITC conjugated
monoclonal antibody and examined under a fluorescent microscope.

In this study of direct immunofluorescense staining, the FITC probe
conjugated to the purified M. fermentans incognitus monoclonal antibodies
which again revealed positive staining only in M. fermentans incognitus,
but not in the other seven species of human mycoplasmas, including M.
fermentans (FIG. 4).
FIG. 4 shows direct immunofluorescence staining of M. fermentans incognitus
(A) and M. fermentans (B) using FITC conjugated monoclonal antibody D81E7
(X900).

EXAMPLE 23

Identification of M. fermentans incognitus Infection in Patients with Aids

Monoclonal antibodies developed against antigens from a pure culture of M.
fermentans incognitus grown in modified SP-4 medium were used to
immunohistologically identify M. fermentans incognitus infection in tissues
of thymus, liver, spleen, lymph node or brain from 26 out of 32 patients
with AIDS. M. fermentans incognitus infection was also identified in 2
placentas delivered by 2 patients with AIDS. The 32 patients tested were
homosexuals, intravenous drug abusers or pediatric patients who had
received transfusions.

M. fermentans incognitus specific DNA was also identified in the subject
tissues using a .sup.35 S labeled psb-2.2 DNA probe and in situ
hybridization. Although M. fermentans incognitus was found to be both
cytopathic and cytocidal, the cellular immune response and inflammatory
reaction to M. incognitus infection was often atypical.

Patient profiles

All 34 AIDS patients were selected according to CDC criteria (JAMA 258,
1143 (1987)). All patients were seropositive for HIV-related antigens.
Unless specified below, all the patients belonged to the homosexual high
risk group.

Four thymic tissues, 10 livers from patients with unexplained abnormal
liver function tests, 8 spleens and 8 brains from patients with clinicalCNS
symptoms obtained at autopsy as well as 2 biopsied lymph nodes were used.
Histopathological studies using special tissue stains did not reveal any
bacterial, fungal or viral infectious agent in these tissues. All tissues
obtained at autopsy and biopsy were previously fixed in 10% buffered
formalin and embedded in paraffin blocks. Tissues of non-AIDS control
subjects were also obtained from 10% formalin fixed and paraffin embedded
blocks of autopsy tissues.

Immunohistochemisty and in situ hybridization

Deparaffinized and frozen section slides were incubated with 10% bovine
serumalbumin (Sigma Chemical Co.) in phosphate-buffered saline (PBS, Gibco
Co., pH 7.4 saline) for 30 minutes, rinsed briefly with PBS, and covered
with monoclonal antibodies (1:600 dilution).

Slides were kept refrigerated overnight. After returning to room
temperature, the slides were rinsed with 1% albumin in PBS. The slides were
then covered with secondary antisera. Biotinylated horse anti-mouse IgG
(H&L) or biotinylated goat anti-mouse IgM (H&L) (Vector Lab., Burlingame,
Calif.) was added at 1:200 dilution in PBS as secondary antisera and
followed by the avidin biotinylated peroxidase complex (ABC) reagent
(Vector Lab, Burlingame, Calif.). Each incubation step was conducted for 1
hour with extensive washing between steps. The color reaction was developed
in DAB-H.sub.2 O.sub.2 substrate and counterstained with hematoxylin.

Development of M. fermentans incognitus-specific monoclonal antibodies
(C42H10, and D81E7) has been described previously in Example 21. In
parallel, non-specific mouse monoclonal antibodies (IgM, MOPC 104E and
IgG.sub.2b K, MOPC 141, Sigma) or monoclonal antibody (ascites) raised
specifically against herpes virus (IgG.sub.1, MCA 255, clone R1,
Bioproducts) were used as the primary antibodies and served as negative
controls in immunohistochemistry. Detailed procedures of preparation of
.sup.35 S radiolabeled psb-2.2 probe and in situ hybridization on
formalin-fixed and paraffin embedded tissues were also described previously
(Lo, S-C et al., Am. J. Trop. Med. Hyg. 41, 380 (1989)).

Electron microscopy

To retrieve formalin-fixed paraffin-embedded tissues for ultrastructural
examination, immunohistochemistry positive areas of tissue sections on
glass slides were circled. These exact area were then matched and
identified on each individual paraffin block. Tissues of 1 to 2 mm in
diameter were punched out from the blocks and deparaffinized in xylene.
Processing of these tissues for E. M. studies were previously described in
detail (Lo, S-C et al., Am. J. Trop. Med. Hyg. 41, 380 (1989)).

RESULTS

Thymus

Many patients with AIDS suffer a profound deficiency in cell mediated
immunity. It is well known that development of competent T-cell immunity is
thymus dependent. Therefore, four thymic tissues available from patients
with AIDS were examined for possible M. fermentans incognitus infection.
Two of the thymic tissues were described grossly at autopsy as involuted
thymus, one from a two year old and the other from a eight year old. Both
of these pediatric patients contracted AIDS from blood transfusions.
The other two thymuses were derived from adult AIDS patients and the
autopsy reports contained no specific gross tissue description.
Immunohisto-chemical studies, using M. fermentans incognitus-specific
monoclonal antibodies, showed positive immunoreaction in all four thymic
tissues. Both mononuclear lymphohistiocytes and epitheloid cells were
stained positively (FIG. 26).

FIG. 26 shows the immunhoistochemistry of thymic tissues derived from
patients with AIDS. FIG. 26A is a low-magnification photograph of a thymus
immunostained by M. fermentans incognitus-specific monoclonal antibody
(C42H10) (X71.5). FIG. 26B is a higher magnification of the positively
immunostained lymphohistiocytes in the junction between cortex and medulla
shown in 26A, left curve arrow (X715). FIG. 26C is a higher magnification
of the positively immunostained lymphohistiocytes in the septal
interstitial tissues in 26A, right curve arrow (X715). FIG. 26D is a
low-magnification photograph of a thymus from another AIDS patient
(X126.5). FIG. 26E is a higher magnification of the positively
immunostained cells in 26D (X142).

Electron microscopic examination of the areas of the thymus with
significant positive immunoreaction showed ultrastructurally many particles
resembling mycoplasma. The particles were located both intracellularly in
the cytoplasm of lymphohistiocytes (FIG. 27 A, B) and apparently
free-growing extracellularly (FIG. 27 C, D). FIG. 27 shows an electron
micrograph of an AIDS thymus immunostained positively for M. fermentans
incognitus-specific antigens. FIG. 27A is an electron micrograph of
mononuclear lymphohistiocytes with many intracytoplasmic electron dense
mycoplasma-like particles (arrows) (N is the nucleus and bar represents 100
nm). FIG. 27B is a higher magnification of the electron dense
mycoplaslma-like particles in the cytoplasm of a mononuclear cell shown in
27A (P is a polysomal structure and bar represents 100 nm). FIG. 27C is an
electron micrograph of many mycoplasma-like particles found both inside the
membrane bound cytoplasmic vesicle (arrow heads) and also extracellularly
in the interstitial tissue (arrows) (N is the nucleus with degenerating
changes, Bar represents 100 nm). FIG. 27D is a higher magnification of the
extracellular mycoplasma-like particles. The outer limiting membrane of
some particles (arrows) can be identified (Bar represents 100 nm).

Most of the nearly spherical particles measured 100-300 nm. No cell wall
was associated with these particles. However, a prominent halo with a clear
space surrounding each of these intracellular particles was commonly noted.

Occasional cells exhibited cytopathological changes and even appeared to be
necrotic. However, most cells in these tissues were morphologically
unremarkable. There was no tissues reactive process and/or an inflammatory
reaction identified.

Liver

Ten livers from patients with AIDS who had unexplained abnormal liver
function tests were examined. Work-ups for both hepatitis B and A
infections were negative in these patients.

Four of these ten livers were positive by immunohistochemistry using M.
fermentans incognitus-specific monoclonal antibodies. Histopathology of
these four livers varied from no pathological changes except mild
periportal infiltrates of lymphohistiocytes (two) to fulminant hepatocyte
necrosis without any inflammatory reaction (one) and patchy areas of
hepatocyte necrosis associated with prominent acute and subacute
inflammation (one). The positively immunostained cells in these livers were
the infiltrating inflammatory cells and the hepatocytes with or without any
evidence of cytopathological changes (FIG. 28). Some areas of sinusoidal
space lined by Kupffer cells were also stained positively.

FIG. 28 shows the immunohistochemistry of livers derived from patients with
AIDS, using monoclonal antibody C42H10. FIG. 28A is a photomicrograph at a
portal area in an AIDS liver with patchy areas of necrosis. Prominent
infiltrates of chronic inflammatory cells and proliferation of bile ducts
(arrows) are identified (X390). FIG. 28B is a higher magnification of the
positively immunostained cells in 28A (X780). FIG. 28C is the same portal
area shown in 28A in a subsequent tissue section immunostained by a
nonspecific monoclonal antibody with the same isotype IgCl/k. Hemosiderin
pigments (arrow heads) are noted (X390). FIG. 28D is an immunohistochemical
photomicrograph of another AIDS liver. No necrosis or histopathological
changes other than mild infiltrates of chronic inflammatory cells in the
portal area (P) can be found in the liver (X390).

The areas of liver showing positive M. fermentans incognitus- specific
antigens were also retrieved from the original paraffin blocks for ultra
structural examination. Microorganisms with typical mycoplasma morphology
were identified in all four livers. These mycoplasma-like microorganisms
could be found intracellularly in the cytoplasms of mononuclear
lymphohistiocytes, Kupffer cells and hepatocytes. Many of these
microorganisms also lined up extracellularly along the walls of sinusoids
(FIG. 29). For comparison, an electron micrograph of M. fermentans
incognitus in the liver of a silvered leaf monkey, experimentally infected
with this pathogen (Example 9) is shown in the insert of FIG. 29E.

FIG. 29 shows an electron micrograph of AIDS liver immunostained positively
for M. fermentans incognitus-specific antigens. FIG. 29A is an electron
micrograph of a periportal area of an AIDS liver with adjacent necrosis. N
is the nucleus of a mononuclear lymphohistiocyte. R is red blood cells in
the small vessel and the bar represents 500 nm. FIG. 29B is a higher
magnification of the mycoplasma-like microorganisms found in the empty
extracellular space and lining along the outer surface of the
lymphohistiocyte shown in 29A. Many intracellular particles (arrow heads)
can also be identified and are difficult to differentiate with the
extracellular particles (P is the polysomal structure and the bar
represents 1200 nm). FIG. 29C is a higher magnification of the
mycoplasma-like microorganisms lining the outer surface of the
lymphohistiocyte (Bar represents 100 nm). FIG. 29D is an electron
micrograph of another AIDS liver which showed no evidence of
histopathological changes except mild portal infiltrates of chronic
inflammatory cells (N is the nucleus and the bar represents 400 nm). FIG.
33E is a higher magnification of the mycoplasma-like particles shown in
29D. The insert shows M. fermentans incognitus in 2% glutaldehyde fixed
liver of experimentally infected silvered leaf monkey at the same
magnification (Bar represents 100 nm).

Lymph node and spleen

Two lymph nodes surgically removed from AIDS patients showed reactive
changes with follicular hyperplasia and foci of sinus histiocytosis. No
areas of necrosis were identified. Positive immunochemical reactions were
seen primarily within the endothelial cells lining the lymphatic sinus or
the mononuclear lymphohistiocytes found in the sinus. Both nuclei and
cytoplasm were stained positively. The typical staining patterns were
similar to the results presented previously, using polyclonal rabbit
antiserum (Lo, S-C et al., Am. J. Trop. Med. Hyg. 40, 213 (1989)).

Sections from four of six autopsy spleens without pathological changes
stained positively with M. fermentans incognitus-specific
monoclonalantibody. Mononuclear histiocytes and reticular cells in
periarterial regions, mononuclear, reticular cells and lymphocytes in areas
of red pulps were the positive cells which often revealed varying degrees
of swelling or disruption. The strongly-stained nuclei and cytoplasm
resembled inclusion bodies in the immunochemical reaction. Positively
stained cells could also be identified in two additional splenic tissues
with areas of prominent necrosis. The positive immunochemical reaction was
concentrated at periphery of the necrosis (data not shown).
Characteristic ultrastructures with morphological features typical of
mycoplasma were identified in all four spleens (including two with
necrosis) and two lymph nodes which were retrieved for electron microscopy.

Brain

More than 60% of patients with AIDS are reported to have abnormal central
nervous system (CNS) symptoms (Navaia, B. A. et al., Ann. Neurol. 19, 517
(1986)). Since most AIDS patients have serological evidence of HIV
infection, the CNS diseases in these patients with AIDS have been called
HIV encephalopathy.

Eight brains from patients with AIDS who had prominent clinical symptoms of
CNS diseases without histopathological diagnosis of a specific infection in
the brains at necropsy were examined. Two of these 8 brains had lesions of
fulminant necrosis and karyorrhexis associated with both acute and subacute
inflammations. Both of these brains were from intravenous drug abusers with
AIDS. One of the other brains had subacute encephalitis with mononuclear
cell infiltration but no necrosis. The remaining 5 brains showed only
atrophy, gliosis and occasional microglial nodules without evidence of
necrosis or inflammation.

All 3 brains with histopathological evidence of acute or subacute
encephalitis stained positively for M. fermentans incognitus-specific
antigens. FIG. 30 shows the positive immunostaining of the acute and
subacute inflammatory cells in the periphery of a necrotic brain lesion.

FIG. 30A is a photomicrograph of the periphery of a necrotic cerebellar
lesion immunostained positively by M. fermentans incognitus-specific
monoclonal antibody (C42H10) (X390). FIG. 30B is a higher magnification of
the periphery of the lesion in 30A and shows both acute and subacute
inflammatory cells immunostained positively (X780). FIG. 30C is also a
higher magnification of the positively stained cells in 30A (X780). FIG.
30D is a photomicrograph of the same periphery area of the necrotic lesion
immunostained by a non-specific monoclonal antibody with the same isotype
IgG1/k. Cells with prominent cytopathological changes and disruption
(arrows) are evident (X780).

Furthermore, three of the 5 brains showing no evidence of inflammation or
necrosis also revealed positive immunostaining. The positively stained
cells showed degenerating changes, and often became inclusion body-like
structures in the gray and white matter. The patterns and characteristics
of positive immunohistochemical staining identified in these histologically
unremarkable brains were comparable to those previously reported, using
rabbit polyclonal antiserum (Lo, S-C et al., Am. J. Trop. Med. Hyg. 40, 213
(1989)).

Ultrastructural confirmation of M. fermentans incognitus infection in these
6 brains which immunostained positively for M. fermentans
incognitus-specific antigens was also performed. Many electron-dense
particles with features of mycoplasma organisms were identified
extracellularly positively for M. fermentans incognitus-specific antigens
was also performed. Many electron-dense particles with features of
mycoplasma organisms were identified extracellularly or in the cytoplasm of
mononuclear lymphohistiocytes located in the periphery of necrosis.
Clusters of particles with morphological features of mycoplasma could also
be identified in the encephalopathy AIDS brains showing positive
immunostaining but with no evidence of necrosis and inflammation (FIG. 31).
Some of the particles had prominent outer membranes. For comparison, the
electron micrograph of M. fermentans incognitus with an apparent outer
limiting membrane identified in cytoplasm of Sb51 cells in culture is shown
in the insert of FIG. 31D.

FIG. 31A is an electron micrograph of mycoplasma-like particles (arrows)
clustered together in the hippocampus. F is a bundle of neuroglialfilament
and N is the nucleus of a mononuclear cell (Bar represents 100 nm). FIG.
31B is a higher magnification of the mycoplasma-like particles shown in
31A.

The outer limiting membrane (small arrows) of some particles is prominent.
(Bar represents 100 nm). FIG. 31C is a higher magnification of the same
particles. FIG. 31D is a high magnification electron micrograph of
mycoplasma-like particles found in the brain stem from another AIDS patient
(large photo to right). The typical particles with well-preserved outer
membrane (small arrows) are shown in an endothelial cell. Cytoplasmic
membrane (large arrows) of the endothelial cells and basement membrane
(arrow heads) of the vessel can be identified. L is the lumen of the
vessel. The insert shows an electron micrograph of VLIA (M. fermentans
incognitus) originally identified in the cytoplasm of sb51 cells, at the
same magnification. The unit membrane of M. fermentans incognitus (small
arrows) is prominent in the well fixed (2% glutaldehyde) and well preserved
culture specimen. Cytoplasmic membrane (large arrows) of the sb51 cell is
also identified (Bar represents 200 nm).

Placentas

Two placentas delivered at full term by two women with AIDS were available
for study. The babies were reported to be normal at birth. However, no
follow-up was available.
Histopathological examination showed occasional infiltrate of acute
inflammatory cells in the chorionic plates in one of the placentas. The
second placenta was histologically unremarkable. The special
histopathological stains did not reveal any pathogens in either of the two
placentas. Immunohistochemical study of both placentas, using M. fermentans
incognitus-specific monoclonal antibodies C42H10 and D81E7, exhibited
positive immunoreaction in areas of Hofbauer cells and stomal connective
tissues in the chorionic villi (FIG. 32). Some decidual cells in the
stratum basalis were also stained positively.

FIG. 32 shows the immunohistochemistry of a placenta delivered by a patient
with AIDS. FIG. 32A is a photomicrograph of placenta tissue positively
immunostained by a M. fermentans incognitus-specific monoclonal antibody
(C42H10). The insert shows the same placental area in a subsequent tissue
section immunostained by a non-specific monoclonal antibody with the same
isotype IgG1/k (X 195). FIG. 32B is a higher magnification of the
positively immunostained cells shown in 32A. The cytoplasm (arrow heads) or
the surface of vacuolated cells (arrows) more often reveals positive
reaction. Cells showing cytopathological changes with both nuclei and
cytoplasms are positively stained (curve arrows) may resemble atypical
inclusion bodies (X780).

Electron microscopic examination of the Hofbauer cells and connective
tissues in the positively stained chorionic villi revealed numerous
particles characteristic of mycoplasma (FIG. 33). Some particles identified
in the Hofbauer cells were probably in membrane bound vesicles.Many
microorganisms, with a wide variation of size, shape and electron density,
appeared to focally colonize in the stomal connective tissue (FIG. 33). A
prominent halo with a clear space surrounding each of these particles was
often noted. No accompanying acute inflammatory cells or other reactive
process was identified. Some apparently better preserved particles
exhibited recognizable outer limiting membranes. However, many of the
mycoplasma-like particles did not have definite outer unit membranes; they
showed only an electron dense internal matrix with a fine granular
configuration.

FIG. 33 shows electron microscopy of an AIDS patient's placenta
immunostained a positively for M. fermentans incognitus specific
antigens.FIG. 33A is an electron micrograph of a Hofbauer cell containing
may mycoplasma-like particles in the cytoplasm. Some particles are
apparently in the membrane bound cytoplasmic vesicles (arrows). N is the
nucleus and I is a cytoplasmic inclusion body (Bar represents 800 nm). FIG.
33B is a higher magnification of the mycoplasma-like particles. Both
spherical electron dense particles (arrow heads) and flask shape particles
(arrows) typical for mycoplasma organisms are found to colonize in the
stomal connective tissue (Bar represents 1000 nm). FIG. 33D is a higher
magnification of the mycoplasma-like particles shown in 33C. Typical
electron dense internal matrix with fine granular configuration of these
particles is shown. Occasional particles contain recognizable outer
membrane (arrows) (bar represents 100 nm). FIG. 33E shows many of the
particles are also those of less electron dense but with granular appearing
internal matrix. These particles often have more prominent outer limiting
membrane (arrows) (Bar represents 100 nm).

Detection of M. fermentans incognitus specific genetic material

M. fermentans incognitus DNA was identified in the tissues of thymus, liver
and spleen from patients with AIDS as well as in the placentas delivered by
two women with AIDS using the .sup.35 S labeled psb-2.2 probe. FIG. 34
shows positive labeling with grains heavily concentrated in cells of livers
and spleen. Cytological and/or histological identification of the specific
"types" of cells containing M. fermentans incognitus DNA, revealed that
they were the Kupffer cells and hepatocytes in the liver showing minimal
histopathological changes (FIG. 34A), the infiltrating lymphoid cells and
histiocytes in portal tracts of another liver (FIG. 34C), and the
lymphocytes in periarteriolar lymphoid sheaths (white pulp) of spleen (FIG.
34D).

In parallel, .sup.35 S-labeled M13 mp 19 vector DNA which did not contain
M. fermentans incognitus DNA, did not elicit any positive signals in the
consecutive sections from these tissues (FIG. 34B). Five tissues of spleen
and liver from three patients who died of non-AIDS conditions were used as
negative controls and also did not reveal any evidence of positive signals.

FIG. 34 shows in situ hybridization for M. fermentans incognitus nucleic
acid in liver and spleen from patients with AIDS. FIG. 34A shows cells with
strong labeling (arrows) are seen in an AIDS liver with no
histopathological abnormally after hybridization with .sup.35 S labeled
psb-2.2 DNA. Higher magnification (insert) reveals dense clusters of grains
over individual hepatocytes or Kupffer cells (X240, X770). FIG. 34B is the
same area of 34A in the consecutive tissue section, hybridized with .sup.35
S-labelled cloning vector DNA not containing M. fermentans incognitus DNA
(X270). FIG. 34C shows lymphocytes and histiocytes with positive labeling
seen in the portal tract infiltrated with mononuclear inflammatory cells in
the liver of another AIDS patient (X770). FIG. 34D shows lymphocytes with
strong labeling seen in the periarteriolar lymphoid sheath of the spleen.
The central arteriole (Ar) is identified. The insert shows higher
magnification of heavily concentrated grains over the lymphoid cells in
this white pulp
(X350, X770).

Kidney

Renal tissues from 203 patients who died of AIDS as defined by the Centers
for Disease Control criteria were selected for study. The patients lived in
various geographic locations including the continental United States (US),
Puerto Rico (PR), Haiti, and Africa. The different racial backgrounds
included in this study were white, black, Hispanic, and Oriental. Risk
activities for AIDS were varied and included intravenous drug abuse (IVDA),
homosexual contact, heterosexual contact, and history of blood transfusion.
The patients had a wide range of opportunistic infectious agent including
Pneumocystis carinii, Toxoplasma gondii, Candida albicans, Cryptococcus
neoformans, Histoplasma capsulatum, Mycobacterium avium-intracellulare, M
tuberculosis, cytomegalovirus, herpes simplex virus, and others.

Of the 203 total patients comprising this study, 20 patients had renal
histopathologic changes characteristic of AIDS-associated nephropathy
(AAN). Group B consisted of 15 patients selected from the remaining 183 who
had no significant clinical or pathologic evidence of renal disease. These
patients were matched as closely as possible with Group A patients in terms
of the distribution of age, gender, race, and risk activities which
Sections of kidney from the autopsies of 203 patients with AIDS, as well as
renal tissues from the five (Group C) controls, were examined by
conventional light microscopy.

Special stains, including periodic acid-Schiff, Grocott's methenamine
silver, Ziehl-Neelsen, mucicarmine, Masson's trichrome, and Brown and
Hopps, were obtained to evaluate glomerular and tubular morphology as well
as to document the presence of various opportunistic infections. For the 20
cases of AAN, glomerular, tubular, and interstitial changes were
semiquantitatively graded and recorded.

Renal tissues from 15 of the 20 patients from Group A and all of the
tissues from Groups B and C were evaluated using monoclonal antibodies
(MABs) against M. fermentans incognitus as described above.

Formalin-fixed, paraffin-embedded sections of kidney were immunochemically
stained with MABs against the incognitus strain, as previously described.
Specific areas of positive staining were circled (approximately 1 mm in
diameter) and removed from the matched paraffin tissue blocks. Tissues were
then deparaffinized and processed as described above. After embedding all
tissues in epoxy resin, semi-thin sections were cut and stained with
alkaline toluidine blue for histologic analysis. The thin sections of the
selected blocks were stained with lead citrate and uranyl acetate and
examined by electron microscopy.

Light Microscopy

For all 20 cases of AAN, the earliest recognizable glomerular change
consisted of relative and actual dilatation of Bowman's space, with
concomittant capillary tuft wrinkling, compression, or complete collapse
(FIG. 1a). Bowman's spaces often contained finely granular proteinaceous
material which was also present in the lumens of adjacent proximal
convoluted tubules. The subsequent glomerular change was "early" segmental
or global glomerulosclerosis, as evidenced by hypertrophy and vacuolization
of visceral epithelial cells and capillary endothelial cells, increased
amounts of mesangial matrix material in either a segmental or global
distribution, and small protein droplets within epithelial cells and
Bowman's space. The most advanced glomerular change was fully evolved
("late") segmental and global sclerosis. In the latter case, glomerular
tufts were transformed to round "sclerotic balls," sometimes surrounded by
a rim of hypertrophic epithelial cells. In this advanced stage,
homogeneous, dense cast material often filled the dilated Bowman's spaces
and contiguous tubular lumens. The peripheral edges of these casts had
scalloped borders, created by side by side "holes" in the cast material
adjacent to tubular epithelial cells.

Tubular changes usually paralleled glomerular changes. In early stages,
tubular epithelial cells with cytoplasmic swelling contained many protein
droplets. Subsequently, tubular lumens became dilated and contained protein
droplets or granular proteinaceous material, as well as degenerated
sloughed epithelial cells. In later stages, tubules showed microcystic
dilatation and were filled by dense cast material. Epithelial cells within
such tubules were flattened from compression by the large proteinaceous
casts. In all cases, variable degrees of interstitial edema and mononuclear
cell inflammation were present. Special tissue stains did not reveal any
evidence of infection with bacteria, fungi, or mycobacteria in these
kidneys.

Sections of renal tissue from the 15 group B patients showed minimal
structural abnormalities including focal mild mononuclear cell infiltration
of the interstitium, rare mononuclear cells within glomerular capillary
lumens, and occasional hyaline casts. Renal tissue from three of the five
group C patients also demonstrated normal histology, renal tissue from the
remaining two showed changes consistent with reflux nephropathy and
moderate to marked nephrosclerosis, respectively.

Immunohistochemistry

For all of the 15 group A patients, there was positive staining by M
incognitus-specific MABs in several locations including glomerular
endothelial and epithelial cells, capillary basement membrane, tubular
epithelial cells, tubular casts, and mononuclear interstitial cells.
Although all cases had positive staining for antigens of this microorganism
in the above locations, six cases showed more prominent positivity in
glomerular epithelial and endothelial cells, while nine cases had greater
positivity in tubular epithelium and casts. Particularly intense staining
could often be seen in partially degenerated cells within the casts, or
within the amorphous cast material itself.

Kidney tissues from group B patients showed positive staining for
incognitus strain-specific antigens only within occasional mononuclear
interstitial cells. These mononuclear cells were either histiocytes or
lymphocytes. None of the cases in this group demonstrated positivity within
the glomerulus or tubules.

The renal tissues of group C patients showed no staining for incognitus
strain-specific mycoplasmal antigens in any locations.

Electronmicroscopy

Electron microscopic examination of tissues from the particular areas
highly positive for incognitus strain-specific antigens revealed structures
strongly resembling mycoplasmal organisms in various locations in all 15
group A cases.

In seven patients, mycoplasma-like structures (MLS) were identified in
glomerular endothelial cytoplasm and in the adjacent capitallary basement
membrane. such endothelial cells often displayed enlargement and
vacuolization, with MLS sometimes localized in clusters within the
vacuoles.

Although 12 patients showed MLS within the glomerular basement membrane,
seven patients, with mor eintense immunoperoxidase staining for the
mycosplasmal antigens within this location demonstrated greater involvement
of the memberane on electron microscopy. Mycoplasma-like structures could
be seen in subendothelial, intramembranous, and subepithelial locations
with accompanying membranopathic changes. These changes consisted of (1)
small holes in the basement membrane surrounding intramembranous MLS, (2)
splits and large irregular defects in the membrane associated with
scattered MLS, (3) thickening of the membrane, associated with
intramembranous MLS, and (4) complete breaks in the basement membrane in
areas of heavy MLS infiltration.

Mycoplasma-like structures were also present within visceral epithelial
cells which often displayed cytoplasmic degeneration, vacuolization, and
partial detachment from the underlying basement membrane. In many instances
these cells were completely detached from the basement membrane, embedded
in proteinaceous cast material within Bowman's space.

Numerous MLS were likewise found within the contiguous large proteinaceous
casts in microcystically dilated tubules. Morphologically, these particles
varied from spherical electron-dense forms to large ovoid, flask-shaped or
undulating forms. My coplasma-like structures were present in great numbers
in detached, degenerated tubular epithelial cells, which were often
incorporated into the casts.

Electron microscopic study of renal tissues of 10 of the 15 group B cases
showed occasional mononuclear interstitial cells containing MLS. Group C
cases displayed no MLS ultrastructurally. Glomerular endothelial
tubuloreticular inclusions were present in the 15 group A and 10 group B
cases, and were absent in the five group C cases.

In this study, we hae identified mycoplasmal infection of the parenchymal
cells in kidneys of AIDS patients with typical histologic changes of AAN.
There is good correlation between the immunohistochemical presence of the
incognitus strain mycoplasmal antigens in visceral epithelial and tubular
epithelial cells demonstrating the cytopathic changes typical of AAN, and
the ultrastructural presence of MLS within the same critical cells. The
same correlation also holds true for other microscopic locations, such as
glomerular endothelial cells and renal tubular casts. The ultrastructural
finding of significant numbers of MLS within the glomerular capillary
basement membrane with evidence of membranopathic effect can be of
particular importance when considering the pathogenesis of this
nephropathy.

In summary, this study documents a spectrum of renal histopathologic
changes which helps further delineate the morphogenesis of AAN. The study
has also demonstrated the mycoplasmal infection of glomerular endothelium,
epithelium, and basement membrane, as well as tubular epithelium, in the
kidneys of AIDS patients with AAN. Infection of these functional
parenchymal cells by M. fermentans (incognitus strain) may have contributed
to the development of glomerulosclerosis, proteinuria, intratubular casts,
and renal failure in these patients with AIDS.

EXAMPLE 24

Enhancement of HIV-1 Cytocidal Effects in CD4.sup.+ by M. fermentans
incognitus
The effects of the M. fermentans incognitus on HIV-1 infection of a
CD4.sup.+ human T lymphocyte cell line, designated previously as A3.01
(Folks, T. et al., Science 231, 600 (1986)).

Normally, HIV-1 infection of human T lymphocytes in vitro produces
pronounced cytopathic effects (CPE) with the release of newly replicated
virus (Lifson et al., Science 232, 1123 (1960)). The formation of large
multinucleated cells, termed syncytia, and high levels of reverse
transcriptase (RT) activity is a characteristic feature of HIV-1 infection
in vitro (Lifson et al., Nature 323, 725 (1986)). A3.01 cells
(5.times.10.sup.7) were infected with () HIV-1 (1.times.10.sup.5 infectious
units) and incognitus strain (1.times.10.sup.3 infectious units), () HIV-1,
or (0) incognitus strain. Cells in each culture were incubated at
37.degree. C. for 2 hours and then washed once with RPMI 1640 medium. The
infectious titer of HIV-1 was previously determined by exposing A3.01 cells
to tenfold serial dilutions of HIV-1 culture stock for 2 hours at
37.degree. C. The highest dilution in which the presence of RT activity
could be detected after 14 days in culture represented one infectious unit.
We grew the incognitus strain in modified SP-4 media and filter-cloned it
three times from a single colony on agar plates (3). The organisms were
washed once and resuspended in RPMI 1640. The titer of incognitus strain
after infection of NIH 3T3 cells was determined by antigen dot blot assay.
The cell cultures were maintained with RPMI 1640 supplemented with 10% FBS.
Large numbers of syncytia formed when HIV-1 alone infected A3.01 cells, but
syncytium formation disappeared in A3.01 cells simultaneously infected with
HIV-1 and incognitus strain (FIG. 35) despite clear evidence of a cytocidal
effect. Results are the average of the number of syncytia per field (X200)
of ten fields examined per culture. The error bars indicate standard
deviation of the mean.

The cytocidal effect and inhibition of RT activity in HIV-1 infected A3.01
cell cultures by M. fermentans incognitus was analyzed. A3.01 cells were
cultured after () infection by HIV-1, () infection by HIV-1 and incognitus
strain, (.DELTA.) infection by incognitus strain, or (*) no treatment. Each
point on each graph is the average of the results of three indipendent
cultures. (A) Cell viability was determined with the Trypan blue exclusion
test with a total of 200 cells counted for each time point. (B) Samples of
culture supernatants were tested daily with the standard RT enzyme assay
using the incorporation of tritiated triphosphate nucleotides (Baltimore et
al., Proc. Natl. Acad. Sci. USA 68, 1507 (1971). Conditions of HIV-1 and
mycoplasma infectious were the same as described above. The culture
infected by mycoplasma alone [indicated by .DELTA. in (A)] also had no
detectable RT activity. The M. fermentans incognitus significanly enhanced
the cytocidal effects of HIV-1 infection in A3.01 cells (FIG. 36A).
Furthermore, populations of cells that had been infected by HIV-1 alone
gradually recovered from the initial cytocidal effect and remained
persistently infected. In contrast, A3.01 cells infected by both HIV-1 and
incognitus strain died. In this study, incognitus strain infection alone
did not produce detectable cytotoxicity. As expected, culture supernatants
from A3.01 cells infected with HIV-1 had clear RT activity. However,
samples from the cointected cell culture shoed little or no RT activity
(FIG. 36B).

Despite the absence of RT activity, virus-specific protein synthesis and
assembly was occurring. This activity was shown by examining culture
supernatants. Culture supernantant (100 ul) was tested for the presence of
viral antigen (HIV-1 antigen assay kit, Integrated Diagnostics,
Gaithersburg, Md.). The assay kit uses an enzyme-linked immunosorbent assay
(ELISA) technique, and the procedures performed in this study were in
strict accordance to the instructions supplied with the kit. The negative
control (phosphate-buffered saline) had an absorbance (A.sub.410) reading
of less than 0.1 at 410 nm. Each point on the graph (FIG. 37A) is the
average of the results of three independent cultures. ()

A3.01+HIV-1, (.DELTA.) A3.01+HIV-1+incognitus strain, (*) A3.01 (FIG. 37B
shows an electron micrograph of a cell culture infected simultaneously with
both HIV-1 and incognitus strain. Numerous viral particles are seen in this
culture with lytic cells. Occasional electron-dense forms of incognitus
strain (arrows) can also be seen. Bar+400 nm. The coinfected cell culture
produced HIV-1-specific p24-p25 as rapidly as the culture infected by HIV-1
alone (FIG. 37A). Electron microscopy of coinfected cells showed typical
HIV virions (FIG. 37B). The assembled virions were infectious. Supernatant
from the coinfected culture, which showed no detectable RT activity, was
tenfold serially diluted and incubated with fresh A3.01 cells. We found
comparable infectious units of HIV-1 (10.sup.5 per milliliter) to be
produced in the supernatants after infection of cell cultures either by
HIV-1 alone or by both HIV-1 and incognitus strain (See, Lo et al., Science
251, 1074 (1991).

To test if substances in cultures infected by incognitus strain directly
affected the RT enzyme assay, culture supernatant from A3.01 cells
coinfected with HIV-1 and incognitus strain was mixed with the culture
supernatant containing HIV with known RT activity. Over 90% of the Rt
activity was inhibited when less than a third of the active supernatant was
replaced by culture supernatants containing both HIV-1 and incognitus
strain. Enzyme inhibition occurred immediately, and prior incubation of the
mixture of culture supernatants was not required. We observed a comparable
degree of inhibition when we used culture supernatant from A3.01 cells
infected with only incognitus strain in the inhibition assay. Thus, the
results can be best explained by the presence of some mycoplasma product or
products in the assay lysate which directly interfered with the RT assay.
Some mycoplasmas have recently been found to produce highly active
nucleases (Marcus et al., J. Cell Physiol 143, 416 (1990), which could
potentially be involved.

The masking effect of HIV RT activity may not be unique to incognitus
strain. Suppression of HIV RT has recently been reported in M.
hyorhinis-contaminated lymphocyte cultures (Vasndevachari et al., AIDS Res.
Hum. Retroviruses 6, 411 (1990). But in contrast to the results in this
report, the HIV-1-infected cultures contaminated by the swine mycoplasma
still formed prominent syncytial cells. Our study indicates that syncytium
formation and the actual cytocidal effect can be separate events. Our
findings support the earlier reports (Sochoski, et al., Nature 322, 470
(1986); Somasundaran, et al., J. Virol 61, 3114 (1987) that state that the
formation of syncytial cells is not a necessary prerequisite for
proliferation of HIV-1.

It has recently been shown that nontoxic doses of the antibiotic
tetracycline may significantly reduce the cytocidal effects of HIV-1
(Lemaitre, et al., Res. Virol. 141, 5 (1990). The tetracycline-treated
cultures continued to produce a high titer of HIV-1. The authors suggested
that a prokaryotic agent, most likely a mycoplasma, was involved with the
cytocidal effect observed in the HIV-infected cultures. Indeed, additional
study and characterization from their laboratory has confirmed that the
hidden agent in the cultures is a mycoplasma (Wright, Science 248, 682
(1990).

Researchers from Japan have reported that just the antigens of killed
mycoplasma (Acholeplasma laidlawii) could stimulate HIV-1 production (p24
antigen and infectious particles) in HIV-1-infected cells (Chorodhurg et
al., Lancet 336, 247 (1990). In our study, approximately equivalent amounts
of HIV antigen or infectious particles were produced in HIV-infected or HIV
and incognitus strain-infected cultures despite significant differences in
the numbers of viable cells. Thus, more HIV-1 may actually have been
produced per individual cell in the coinfected culture; this finding is
similar to the findings of the Japanese researchers.

AIDS patients can be infected with a number of pathogenic mircrobes and
frequently are systemically infected with the incognitus strain (Lo et al.,
Am. J. Trop. Med. Hyg. 40, 213 (1989); Lo et al., Ibid 41, 601 (1989).
Thus, the observation that coinfection by incognitus strain profoundly
enhances cytocidal effects of HIV-1 infection in vitro.

While the invention has been described in connection with specific
embodiments thereof, it will be understood that it is capable of further
modifications. The description of the invention is intended to cover any
variations, uses or adaptations of the invention following, in general,the
principles of the invention, and includig such departures from the present
disclosure as come within known and customary practice within the art to
which the invention pertains.

__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 17
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: RS 48 Probe
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GTTAGTTTTGGCATAAATCCCC22
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2210 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasmaa fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: psb 2.2
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GAATTCTTTAATTGAGTTGCTCATTCTTGTTTCTTGAGTTTCAGTTAGTTTTGGCATAAA60
TCCCCCCTTGTTTTTTATATTTAAATTATACTTTAAAGATTGTTAAAAAAACAATCATAT120
GATTGTTTTAGAGTGAACCCCAAATTCCGGACTTTTTGGA AAGGGGTTCATTTTTATGCA180
ATTTAAATTTAAAAAAGTAAAAAGAAACAAATGAAATAGAGATATAAAAGGTTATTTAAA240
ATTAAAACTTGATCAAAAGATAAAAATTATCGAGTTATATTTTCAAGAATTTAGTATTTT300
AGAAATATCTAAAATAAT GGAAAACTCTTATTCAGCATGCTATTCAGTAATAGAAAAATA360
CAAAAAGTTTGGTTATAATTCTTTTGCTATGGAAAAGAAAAAAGGAAGAAAATCTAAAAT420
AAATTTAGATGCTCAAAAGGCAACAAATTTTAAAATCAATATTGAAAATAAAATAGAAAA 480
TAAAGATTTATTAATTAAACAATTAAAGGAAGAAAATAAAATACTCAAATTGGAGAATGC540
GATAGCAAAAAAAGTGAGCGCCTTGGTTCAATTGAAAGACTCACTAACAAAGAAAAATTC600
CAAATAACAATTGAACTAAGGCAAGAATTTAAAAAGCTAT TTTTTATTAAATTAATATTA660
GAAAAAATTAAATTGAAAAAGTCAACTTTTTATGAGATATTAAAATCACAAAATAAACCT720
GATAAAGATGAAAATTTAAAAAAGGTTATTTTTGACTTATTTAACTATAATAAAGGACTA780
TACGGTTATAGACGTATT ACTTTTGCTTTAAGAAATAAAGGAATAATAATCAATCATAAA840
AAAGTTCAAAAATTAATCGAAAGCAATGAATATTTTCGGCAAAACGCTAAGAAGAAAAAA900
TAAATATTCTTCATTCAAAGGTGATGCTCACAAAACATTCCAAACTTGCTTTTAGATAAA 960
GAAATATCACAGAAGATTTCTTCAGATACAAAAGAAATTTTTCAAATAATAAATATTTGA1020
AAATACTAGGAACAGATGTTACTGAATTTAAATTAAAAAATGATGAAAAAGCATATTTTT1080
CTCCTGTAGTTGATTTTGAAAACAGAGAGATTTTAGGTTA TTCGATTTCTAAATCGCCTA1140
ATTTAAGAATGGTTGGTAAAATGTTAGAAAACGTAGAAGAGAATGGCCACAGCTTAAAAA1200
ATGTATTATTACATTCTGATCAAGGATGACAATACACTCATCAAGATTATATTGATTATT1260
TGAAAGAAAAACAAACAA CTCAAAGCATGTCAAGAAAGGGAAATTGTTTAGACAATAGTC1320
CTACTGAATGTTTATTTAGTGTTATAAAAAGAGAATTTTGATTTGGAGAAGAAAAGAAAT1380
TTAATAGTTTTAAAGAATTTAAAACTGCTTTAGGAGATATATTTCATATTATAATAATGA1 440
CAGAATTGTTAATAAATTAAAAGACTTAGTCCTGTCCAATACAGGAATAAGTCCAAACAT1500
AATTAAAAAGTCCAATTTTTGGGGTTCATACCATTTTGTGGAATTTTTCTTTTTTGCCAA1560
TTTTTACCAAAGCACTATAAAACAGGCTTTTTAGAATTTT TCAAGCATTTCCATTTGTTT1620
TTTAGGATATTTTTTAAATCGCAAATTTAACAAATTTTCTTATAGATGCTTCTATTTCTT1680
GTTCTGATTTTTTAAGACCTATTTTTTTGATTAAACCATATTCAATGAAAAATAAAATTA1740
ATAAATAAAGAGAAAGAA TTGTGAGTATTGAAAAGACACAAATTAAAACTCAAAGTAAAG1800
TTGTATATGTGATTGATGGTGCCGCTTTATTTTGTCAAGCATAAGCGATTACAGTTATGA1860
TCAATAGAATTATCATAAAAATAAATAGGAGTCCAAAAGCTTTAATATTCATTTGATTTC1 920
TAAGATTTAAATGATCTAAATTGCTTTTGTACACTTTTTTATAAGCTTCTACTTTTTCTT1980
CAAAAGAATATTTTTTCTTTTGCGTTTTTTATTTCTTGATCCATAACTTTCTCCTAATCA2040
AAAGTAACATTCTTTAAGTTTTTGATTCAATTCAATATAT ATTTATATGTTCGGTCAAAA2100
TCTATTTTTTTATCAACTTTAAAGTTTTTATTATCAGCAATTTGAGCTTCTATGTTATAA2160
GCTTCAGTTTCGCTCAAATCATCCTTTGATTCAATATCAATATTGAATTC2210
(2) INFORMATION FOR SEQ ID NO:3:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1405 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: IS element
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
TAGAGTGAACCCCAAATTCCGGACTTTTTGGAAAGGGGTTCATTTTTATGCAATTTAAAT60
TTAAAAAAGTAAAAAGAAACAAATGAAATAGAGATATAAAAGGTTATTTAAAATTAAAAC120
TTGATCAAAAGATAAAAATTATCGAGTTATATTT TCAAGAATTTAGTATTTTAGAAATAT180
CTAAAATAATGGAAAACTCTTATTCAGCATGCTATTCAGTAATAGAAAAATACAAAAAGT240
TTGGTTATAATTCTTTTGCTATGGAAAAGAAAAAAGGAAGAAAATCTAAAATAAATTTAG300
ATGCTCAAAAG GCAACAAATTTTAAAATCAATATTGAAAATAAAATAGAAAATAAAGATT360
TATTAATTAAACAATTAAAGGAAGAAAATAAAATACTCAAATTGGAGAATGCGATAGCAA420
AAAAAGTGAGCGCCTTGGTTCAATTGAAAGACTCACTAACAAAGAAAAATTCCAAAT AAC480
AATTGAACTAAGGCAAGAATTTAAAAAGCTATTTTTTATTAAATTAATATTAGAAAAAAT540
TAAATTGAAAAAGTCAACTTTTTATGAGATATTAAAATCACAAAATAAACCTGATAAAGA600
TGAAAATTTAAAAAAGGTTATTTTTGACTTATTT AACTATAATAAAGGACTATACGGTTA660
TAGACGTATTACTTTTGCTTTAAGAAATAAAGGAATAATAATCAATCATAAAAAAGTTCA720
AAAATTAATCGAAAGCAATGAATATTTTCGGCAAAACGCTAAGAAGAAAAAATAAATATT780
CTTCATTCAAA GGTGATGCTCACAAAACATTCCAAACTTGCTTTTAGATAAAGAAATATC840
ACAGAAGATTTCTTCAGATACAAAAGAAATTTTTCAAATAATAAATATTTGAAAATACTA900
GGAACAGATGTTACTGAATTTAAATTAAAAAATGATGAAAAAGCATATTTTTCTCCT GTA960
GTTGATTTTGAAAACAGAGAGATTTTAGGTTATTCGATTTCTAAATCGCCTAATTTAAGA1020
ATGGTTGGTAAAATGTTAGAAAACGTAGAAGAGAATGGCCACAGCTTAAAAAATGTATTA1080
TTACATTCTGATCAAGGATGACAATACACTCATC AAGATTATATTGATTATTTGAAAGAA1140
AAACAAACAACTCAAAGCATGTCAAGAAAGGGAAATTGTTTAGACAATAGTCCTACTGAA1200
TGTTTATTTAGTGTTATAAAAAGAGAATTTTGATTTGGAGAAGAAAAGAAATTTAATAGT1260
TTTAAAGAATT TAAAACTGCTTTAGGAGATATATTTCATATTATAATAATGACAGAATTG1320
TTAATAAATTAAAAGACTTAGTCCTGTCCAATACAGGAATAAGTCCAAACATAATTAAAA1380
AGTCCAATTTTTGGGGTTCATACCA 1405
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: left inverted repeat
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
TAGAGTGAACCCCAAATTCCGGACTTTTT29
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: right inverted repeat
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
AAAAAGTCCAATTTTTGGGGTTCATACCA 29
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 429 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: ORF-1
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
ATGCAATTTAAATTTAAAAAAGTAAAAAGAAACAAATGAAATAGAGATATAAAAGGTTAT60
TTAAAATTAAAACTTGATCAAAAGATAAAAATTATCGAGTTATATTTTCAAGAATTTAGT 120
ATTTTAGAAATATCTAAAATAATGGAAAACTCTTATTCAGCATGCTATTCAGTAATAGAA180
AAATACAAAAAGTTTGGTTATAATTCTTTTGCTATGGAAAAGAAAAAAGGAAGAAAATCT240
AAAATAAATTTAGATGCTCAAAAGGCAACAAATTTTA AAATCAATATTGAAAATAAAATA300
GAAAATAAAGATTTATTAATTAAACAATTAAAGGAAGAAAATAAAATACTCAAATTGGAG360
AATGCGATAGCAAAAAAAGTGAGCGCCTTGGTTCAATTGAAAGACTCACTAACAAAGAAA420
AATTCCAAA 429
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 309 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: ORF-2
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
ATGGTTGGTAAAATGTTAGAAAACGTAGAAGAGAATGGCCACAGCTTAAAAAATGTATTA60
TTACATTCTGATCAAGGATGACAATACACTC ATCAAGATTATATTGATTATTTGAAAGAA120
AAACAAACAACTCAAAGCATGTCAAGAAAGGGAAATTGTTTAGACAATAGTCCTACTGAA180
TGTTTATTTAGTGTTATAAAAAGAGAATTTTGATTTGGAGAAGAAAAGAAATTTAATAGT240
TTTAAAGAA TTTAAAACTGCTTTAGGAGATATATTTCATATTATAATAATGACAGAATTG300
TTAATAAAT309
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 276 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: ORF-3
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
ATGAATATTAAAGCTTTTGGACTCCT ATTTATTTTTATGATAATTCTATTGATCATAACT60
GTAATCGCTTATGCTTGACAAAATAAAGCGGCACCATCAATCACATATACAACTTTACTT120
TGAGTTTTAATTTGTGTCTTTTCAATACTCACAATTCTTTCTCTTTATTTATTAATTTTA180
TTT TTCATTGAATATGGTTTAATCAAAAAAATAGGTCTTAAAAAATCAGAACAAGAAATA240
GAAGCATCTATAAGAAAATTTGTTAAATTTGCGATT276
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 143 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: ORF-1
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
MetGlnPheLysPheLysLysValLysArgAsnLysTrpAsnArgA sp
151015
IleLysGlyTyrLeuLysLeuLysLeuAsnGlnLysIleLysIleIle
202530
GluLeuTyrPheGlnGluPheSerIleLeuGluIleSerLysIleMet
354045
GluAsnSerTyrSerAlaCysTyrSerValIleGluLysTyrLysLys
505560
PheGlyTyrAsnSerPheAlaMetGluLysLysLysGlyArgLysSer
65707580
L ysIleAsnLeuAspAlaGlnLysAlaThrAsnPheLysIleAsnIle
859095
GluAsnLysIleGluAsnLysAspLeuLeuIleLysGlnLeuLysGlu
100105110
GluAsnLysIleLeuLysLeuGluAsnAlaIleAlaLysLysValSer
115120125
Ala LeuValGlnLeuLysAspSerLeuThrLysLysAsnSerLys
130135140
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 103 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: ORF-2
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
MetValGlyLysMetLeuGluAsnValGluGluAsnGlyHisSerLeu
15 1015
LysAsnValLeuLeuHisSerAspGlnGlyTrpGlnTyrThrHisGln
202530
AspTyrIleLysTyrLeuLys GluLysGlnThrThrGlnSerMetSer
354045

ArgLysGlyAsnCysLeuAspAsnSerProThrGluCysLeuPheSer
5055 60
ValIleLysArgGluPheTrpPheGlyGluGluLysLysPheAsnSer
65707580
PheLysGluPheLysThrAlaLeuGly AspIlePheHisIleIleIle
859095
MetThrGluLeuLeuIleAsn
100
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 92 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: ORF-3
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
MetAsnIleLysAlaPheGlyLeuLeuPheIlePheMetIle IleLeu
151015
LeuIleIleThrValIleAlaTyrAlaTrpGlnAsnLysAlaAlaPro
2025 30
SerIleThrTyrThrThrLeuLeuTrpValLeuIleCysValPheSer
354045
IleLeuThrIleLeuSerLeuTyrLeuLeuIleLeuPhePheIle Gly
505560
TyrGlyLeuIleLysLysIleGlyLeuLysLysSerGlyGlnGlyIle
65707580
GlyAlaSerIleArgLysPheValLysPheAlaIle
8590
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(v ) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Escherichia coli
(vii) IMMEDIATE SOURCE:
(B) CLONE: IS3
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
AsnValIleValHisThrAspArgGlyGlyGlnTyrCysSerAlaAsp
1510 15
TyrGlnAlaGlnLeuLysArgHisAsnLeuArgGlySerMetSerAla
202530
LysGlyCysCysTyrAspAsnAlaCysValGlu SerPhePheHisSer
354045
LeuLysValGluCysIleHisGlyGlu
5055
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: RS 47 Primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GAATTCTTTA ATTGAGTTGCTC22
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: RS 49 Primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
TCCAAAAAGTCCGGAATTTGGGG23
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Myccoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: RW004 Primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
GGACTATTGTCTAAACAATTTCCC24
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: RW005 Primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
GGTTATTCGATTTCTAAATCGCCT24
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mycoplasma fermentans
(B) STRAIN: incognitus
(vii) IMMEDIATE SOURCE:
(B) CLONE: RW006 Probe
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
GCTGTGGCCATTCTCTTCTACGTT24

MainPage
http://www.rense.com

This Site Served by TheHostPros